ID: 1044355090

View in Genome Browser
Species Human (GRCh38)
Location 8:91213158-91213180
Sequence GGAGAGCAGGACCACTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044355081_1044355090 21 Left 1044355081 8:91213114-91213136 CCTTGTGAAATTCAGAGGATATT 0: 1
1: 0
2: 2
3: 19
4: 300
Right 1044355090 8:91213158-91213180 GGAGAGCAGGACCACTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044355090 Original CRISPR GGAGAGCAGGACCACTGTGT GGG Intronic
No off target data available for this crispr