ID: 1044360200

View in Genome Browser
Species Human (GRCh38)
Location 8:91274214-91274236
Sequence TATCCTAGTTTATGTTCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044360200_1044360202 24 Left 1044360200 8:91274214-91274236 CCACTAGAACATAAACTAGGATA No data
Right 1044360202 8:91274261-91274283 CAAAGACAAAGATTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044360200 Original CRISPR TATCCTAGTTTATGTTCTAG TGG (reversed) Intronic