ID: 1044360202

View in Genome Browser
Species Human (GRCh38)
Location 8:91274261-91274283
Sequence CAAAGACAAAGATTTTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044360200_1044360202 24 Left 1044360200 8:91274214-91274236 CCACTAGAACATAAACTAGGATA No data
Right 1044360202 8:91274261-91274283 CAAAGACAAAGATTTTTATTTGG No data
1044360198_1044360202 26 Left 1044360198 8:91274212-91274234 CCCCACTAGAACATAAACTAGGA No data
Right 1044360202 8:91274261-91274283 CAAAGACAAAGATTTTTATTTGG No data
1044360199_1044360202 25 Left 1044360199 8:91274213-91274235 CCCACTAGAACATAAACTAGGAT No data
Right 1044360202 8:91274261-91274283 CAAAGACAAAGATTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044360202 Original CRISPR CAAAGACAAAGATTTTTATT TGG Intronic