ID: 1044361480

View in Genome Browser
Species Human (GRCh38)
Location 8:91289857-91289879
Sequence TTCTTTGGTAATATAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044361480_1044361488 13 Left 1044361480 8:91289857-91289879 CCTACCTCTATATTACCAAAGAA 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1044361488 8:91289893-91289915 ATTTGGTATTAGATAAACCTGGG No data
1044361480_1044361486 -4 Left 1044361480 8:91289857-91289879 CCTACCTCTATATTACCAAAGAA 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1044361486 8:91289876-91289898 AGAAAATATGAGGGGTGATTTGG No data
1044361480_1044361487 12 Left 1044361480 8:91289857-91289879 CCTACCTCTATATTACCAAAGAA 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1044361487 8:91289892-91289914 GATTTGGTATTAGATAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044361480 Original CRISPR TTCTTTGGTAATATAGAGGT AGG (reversed) Intronic
903007402 1:20307818-20307840 TTTTTTTGTAATATAGATTTTGG + Intronic
905222253 1:36456228-36456250 CTCTTCGGTAATACAGAGGGGGG + Exonic
905982255 1:42240190-42240212 TTGTTTGTTTTTATAGAGGTAGG + Intronic
906024767 1:42664328-42664350 TTCTCTGGGAATCTGGAGGTGGG - Intronic
906842479 1:49154547-49154569 TTCTTTTGTGATACAGAAGTTGG - Intronic
909947401 1:81679052-81679074 GTCTTTTGTAATTTAGAGGAGGG - Intronic
910395376 1:86788331-86788353 TTGTTTGTAAATATACAGGTTGG + Intergenic
911308819 1:96267143-96267165 TTCTTTTGAAAAATAGGGGTGGG - Intergenic
912533635 1:110345789-110345811 GTCTTTGGTAACATAGATGAGGG + Intronic
914257928 1:145975706-145975728 TTTTTTTGTAAAATAGAGATAGG + Intronic
915067906 1:153242067-153242089 TTCTTTAGTAATTTATAGGTTGG - Intergenic
916194020 1:162206632-162206654 TTTTTTGTTAATATACAAGTAGG + Intronic
916423525 1:164659406-164659428 AGCTTTGTTAATATAGAGGGAGG - Intronic
917266402 1:173225137-173225159 TTATGTGGTAAGAAAGAGGTTGG + Intergenic
917508521 1:175650626-175650648 TTGATGGGTAATATTGAGGTGGG - Intronic
919203923 1:194395582-194395604 TTCTTTGATAAAACAGTGGTGGG - Intergenic
920600131 1:207316732-207316754 TACTTTGGTAGCATAGAGGAAGG + Intergenic
922676554 1:227556348-227556370 TTTTTTGATAACATATAGGTAGG - Intergenic
924179009 1:241422933-241422955 TTTTTTTTTAATATAGAGATGGG + Intergenic
924485516 1:244479763-244479785 TTCTGTGGTACTATAGAGTTAGG + Exonic
1063401374 10:5749198-5749220 TTCTTTTGTTATAGAGAAGTTGG - Exonic
1064267668 10:13838092-13838114 TTATTTAGTTATTTAGAGGTAGG + Intronic
1065265192 10:23967802-23967824 TTATTTGGTAATATATAATTTGG + Intronic
1065509806 10:26467075-26467097 TTTTTTTTTAATATAGAGATGGG + Intronic
1068145436 10:53063783-53063805 TTCTTTGGTCATATAAAGATGGG + Intergenic
1069403195 10:68071148-68071170 TTATTTGGTAATGTAAAGTTGGG - Intronic
1069522413 10:69134338-69134360 ATCTTTGGTAATATGGACATCGG + Intronic
1072093231 10:92150261-92150283 TTTTTTTTTAATATAGAGATGGG + Intronic
1075277452 10:121107011-121107033 GTCTTTTGTGATATAGAGATGGG - Intergenic
1076060751 10:127412327-127412349 TTATTTTTTTATATAGAGGTGGG + Intronic
1077435596 11:2537431-2537453 TTTTTTGGGAAAATAGAAGTGGG + Intronic
1077838419 11:5945645-5945667 ATCTTACCTAATATAGAGGTTGG - Intergenic
1078586066 11:12590337-12590359 TTCTTTGCTAATATGGATGTTGG + Intergenic
1081142789 11:39523477-39523499 TTTTTTAGTAATATAGGGATAGG + Intergenic
1082247166 11:49937359-49937381 TTCTTTGGTAATATTTAATTGGG - Intergenic
1082563471 11:54647283-54647305 TTCTTTGGTAATATTTAATTGGG + Intergenic
1082900024 11:58238223-58238245 TTCTATGGTAAAATGGAGCTGGG - Intergenic
1083032232 11:59603706-59603728 TTTGTAGTTAATATAGAGGTGGG + Intronic
1083912697 11:65719500-65719522 TTCTTTTGTAAAGTAGAAGTTGG + Exonic
1085505976 11:77059362-77059384 TGCTCTGCTAATCTAGAGGTCGG - Intergenic
1085553269 11:77395207-77395229 TGCTTTGGGAATATGGAGGAGGG - Intronic
1085618788 11:78022241-78022263 TTGTTTGTTAAAATAGAGATGGG - Intronic
1086939964 11:92785556-92785578 TTTTTTGGTTATATATATGTAGG - Intronic
1088999369 11:115038272-115038294 TTTTTTGGTGTTATAGATGTAGG - Intergenic
1090105054 11:123844459-123844481 ATCTTTCGTAGTTTAGAGGTGGG + Intergenic
1090621601 11:128565779-128565801 TTATTTGGTACTAGAGAAGTGGG - Intronic
1097856289 12:64466583-64466605 TACTTTGGTTATATATATGTGGG - Intronic
1097877314 12:64655340-64655362 TTCTTTGATAAGAGAGAGGCAGG + Intronic
1098141508 12:67454484-67454506 TTTTGTGGTAATATAGAAGGAGG - Intergenic
1098282927 12:68879741-68879763 TTCTTGGGTAATCTCTAGGTTGG - Intronic
1099095894 12:78373973-78373995 TTGTTTCCTAATTTAGAGGTTGG + Intergenic
1099505774 12:83474476-83474498 TTCTTTGGTGATGTATTGGTGGG + Intergenic
1099754736 12:86830855-86830877 TTCTTTGGAAATGTAGAGTGGGG - Intronic
1100684863 12:96976529-96976551 TTCCATGGAAATAGAGAGGTTGG + Intergenic
1101498394 12:105277895-105277917 TGCTTGGGTAATTTAGGGGTGGG + Intronic
1101770501 12:107745763-107745785 TTCTTTGGAAATATAAAATTAGG - Intronic
1102981609 12:117245945-117245967 ATTTTTGGTAATATAGGGATAGG + Intronic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1106746372 13:32712680-32712702 TTATTTGCTAATTTAGAGGGAGG + Intronic
1108281633 13:48867696-48867718 TTATCAGGTTATATAGAGGTGGG + Intergenic
1109143604 13:58748590-58748612 TTCTTTGATTATACAGAGTTAGG + Intergenic
1109369533 13:61404047-61404069 TTCTTTTGAAATATAGTGGCAGG + Intergenic
1109580282 13:64322287-64322309 TCCATTGGTAGTATAGAGGATGG - Intergenic
1109773568 13:67009355-67009377 TTCTTTTGCTAGATAGAGGTGGG + Intronic
1110228047 13:73140467-73140489 TTCTTTTTTAAAATAGAGATGGG + Intergenic
1110919114 13:81062669-81062691 TTTTGTGGAAATATAAAGGTAGG + Intergenic
1111332957 13:86784758-86784780 TACTTTGGTCATTTAGAGTTAGG + Intergenic
1111881568 13:93964053-93964075 TTCTTTGGTAATACATGAGTGGG - Intronic
1111925892 13:94463140-94463162 TTCTTTTTTAATTTAGAGATAGG + Intronic
1114772338 14:25442395-25442417 TTTTTTGGTAATATAAAAGGAGG - Intergenic
1115369614 14:32597547-32597569 TTCATAGGTAATATATAGTTTGG + Intronic
1118640604 14:67788748-67788770 TGCCTTAGTAATATAGAGGGAGG - Intronic
1120708549 14:87770136-87770158 TTATTTAGAAATATAGAGGAAGG + Intergenic
1123094123 14:105757435-105757457 TTCTTTAATAAAATAGAGATGGG + Intergenic
1124160589 15:27265145-27265167 TTTTTTGGTAAAATGGAGGAGGG - Intronic
1126196545 15:45937879-45937901 TTCTTTGGTAAAATGAAGATTGG - Intergenic
1126463828 15:48942236-48942258 TGCTTTGGAAATAAAGGGGTTGG - Intronic
1127025759 15:54804368-54804390 TTTTGTGGTAACATAGAGTTTGG + Intergenic
1127431405 15:58913009-58913031 TTCTTTGGTTATATCAAGGGTGG - Intronic
1127432949 15:58929595-58929617 TTCTTTTTTAAAATAGAGATAGG + Intronic
1127590303 15:60415740-60415762 TTGTTTGTTAATATAGAGATGGG - Intergenic
1130714413 15:86317361-86317383 TTCCTTGGTAATAAAGAGCAAGG + Intronic
1133183757 16:4080168-4080190 TTCTTTGTTAAAATTGATGTTGG - Intronic
1133857891 16:9566640-9566662 TTTTTAAGTAATATAGAGTTAGG + Intergenic
1135203738 16:20464031-20464053 TTCTTTGCTAAAATATAGGAAGG + Intronic
1135215264 16:20560905-20560927 TTCTTTGCTAAAATATAGGAAGG - Intronic
1137784726 16:51128878-51128900 TTCTTTGGCTATATAGAGGTTGG - Intergenic
1140187631 16:72788761-72788783 TTATTTGGTAATCCAGAAGTGGG + Exonic
1146785826 17:35720592-35720614 TTTTTTTTTAATATAGAGATAGG + Intronic
1146952174 17:36914375-36914397 TTCTTTTTAAAGATAGAGGTGGG - Intergenic
1147530776 17:41275299-41275321 TTCTTTGGTTGTATGTAGGTTGG - Intergenic
1148181938 17:45612490-45612512 TTTTTTTTTAATATAGAGATGGG - Intergenic
1149693736 17:58600002-58600024 TTCTTTTGTTTTATAGAGATGGG + Intronic
1158616264 18:58990638-58990660 TTCTTTGGAAATCTAGATTTGGG + Intergenic
1159509949 18:69383948-69383970 TTCTTTGGTAAAACTGAAGTTGG - Intergenic
1161742505 19:6031822-6031844 TTCTTTTTTAAAAAAGAGGTGGG + Intronic
1163653167 19:18530628-18530650 TTTTTTTTTAATAAAGAGGTGGG - Intergenic
1165166068 19:33857732-33857754 TTGTTTTTTAATATTGAGGTTGG - Intergenic
1165292321 19:34897058-34897080 TTATTTTTTAATATAGAGATGGG + Intergenic
1166090788 19:40507520-40507542 TTCTTTTTTGATATAGAGATGGG - Intronic
1167992018 19:53368732-53368754 TTTTTTGATAACATATAGGTAGG + Intronic
927306055 2:21574488-21574510 TTCTGTGGCAATAAAAAGGTGGG + Intergenic
929389491 2:41453133-41453155 TCCTTTTGTAACACAGAGGTTGG - Intergenic
929850573 2:45585194-45585216 TTCTTTGGCAGTATAGAGTTTGG - Intronic
935135298 2:100295019-100295041 TAATTTTTTAATATAGAGGTGGG + Intronic
937307874 2:120883312-120883334 TTCTTTTTTAAAATAGAGATGGG - Intronic
937460684 2:122083213-122083235 TTCTTTGGTAAAGTAAAGGGAGG + Intergenic
938220902 2:129566727-129566749 TTCTGTGTTAATGTAAAGGTGGG + Intergenic
939591071 2:144064607-144064629 TTATTTAGCAATATAGAAGTAGG + Intronic
940304274 2:152208733-152208755 TTATTTGGGAAAACAGAGGTAGG + Intergenic
941949084 2:171134547-171134569 TTCTTTGGATATATAGAAATGGG - Intronic
942224946 2:173806881-173806903 TGCTTTGGGAACATAGATGTTGG - Intergenic
943400285 2:187400686-187400708 TTATTTGGCAATAAAGAGGAAGG + Intronic
943402997 2:187439611-187439633 GTCTGTGGTAGTATAGACGTAGG + Intronic
943464236 2:188208803-188208825 TTCTTTGGCAATACAGAAGAAGG - Intergenic
943490341 2:188546040-188546062 TTTTTTGGTAATACACAGTTAGG - Intronic
945368392 2:208985248-208985270 TTCTTTTGAAATAAGGAGGTTGG + Intergenic
946813847 2:223555223-223555245 TTATGTGGTAAGATAGAGGTTGG - Intergenic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1175200473 20:57273467-57273489 TTCTTTGGTTACATAGAGCAGGG + Intergenic
1175528059 20:59649498-59649520 TTTTGTGGTAATATAAAGGACGG + Intronic
1177083428 21:16671348-16671370 TTCTTCGGTAATAAATAAGTAGG + Intergenic
1177941584 21:27418393-27418415 ATCCTTGGTAAAATAGAGCTGGG - Intergenic
1179055255 21:37925898-37925920 TTATTTGGTAAAATAGTGATGGG + Intergenic
949433342 3:4002261-4002283 TTCTTTGCTAATTAAAAGGTTGG - Intronic
949745314 3:7284806-7284828 TACTTTTGTAATATAGAGGGGGG - Intronic
951127369 3:18999582-18999604 TTCTTTGGAAATCCAGAGGGTGG - Intergenic
951353971 3:21641645-21641667 TTTTTTTTTAATATAGAGATGGG + Intronic
952458148 3:33494049-33494071 TTCTTTTGTATTTTAGAGATGGG + Intergenic
953783629 3:45894125-45894147 TTCTTTGGTTATGTAGGGGTGGG + Intronic
956328948 3:68083887-68083909 TCCTGTGGTAATATACAGGTCGG - Intronic
956524000 3:70137140-70137162 TCCTTTGGTCATATAGAATTAGG + Intergenic
956613286 3:71145842-71145864 TTGTTTTGTATTATAGAGTTTGG + Intronic
956985277 3:74691834-74691856 GTCTCTGTTAATATAGTGGTGGG - Intergenic
957205162 3:77187981-77188003 GTTTATGGTAATAGAGAGGTTGG - Intronic
958724106 3:97882515-97882537 TTCTGTGGTAGTATAGAGGAGGG + Intronic
963593689 3:147298243-147298265 TTCTCTGCTAATACAGGGGTGGG + Intergenic
964363249 3:155920943-155920965 GTATTTGGTAAAATAGAGGTTGG + Intronic
964608029 3:158579569-158579591 TTCTTTCTTTATATAGAAGTAGG - Intronic
964775175 3:160267736-160267758 TTATTTGTTTATTTAGAGGTGGG + Intronic
965218726 3:165898822-165898844 TTCTTTAGTAATTTATAGGCAGG + Intergenic
965592582 3:170376407-170376429 CTCTTTGGTCATGTAGAGCTGGG + Intronic
966212637 3:177469172-177469194 TTCTCTTGAACTATAGAGGTGGG + Intergenic
967549270 3:190770775-190770797 TTCTTTGTTATTTTTGAGGTTGG + Intergenic
968973295 4:3807737-3807759 TTCTTTTGTATTTTTGAGGTGGG - Intergenic
969557277 4:7920659-7920681 TTCTTTGGTAAGAGAAAGGTTGG - Intronic
969663506 4:8544079-8544101 TTCCTGGGTAATGGAGAGGTGGG - Intergenic
972650029 4:41007938-41007960 TTCTTTGGGAATACAGAGAAAGG + Intronic
973535197 4:51874204-51874226 TTCTTTGGAAGTACAGAGTTAGG + Intronic
974617368 4:64307042-64307064 GTCTTTGAAAATATAGGGGTTGG - Intronic
976009995 4:80475412-80475434 TTCTTTGGAAATAGAGTGGCAGG + Intronic
979519370 4:121649143-121649165 TTCTTTTGTGATATCGAGGAAGG - Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
981002986 4:139845981-139846003 TTCTCTGTTTATATAGATGTTGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981771374 4:148312886-148312908 TTCTTTGGTAATATTTAATTGGG - Intronic
982029863 4:151289906-151289928 TTCTTTGTTTATTTAGAGATGGG - Intronic
982867688 4:160537982-160538004 TTTTTTGGTAAGAAAGAGTTCGG - Intergenic
983196617 4:164813586-164813608 TTTTTTTTTAATATAGAGATGGG - Intergenic
983632516 4:169863659-169863681 TTTTTTTTTAATATAGAGATGGG + Intergenic
983730587 4:170988744-170988766 TTCTTTGTTAATCTAGCTGTGGG + Intergenic
983737238 4:171077202-171077224 TTATTTGGTAAGTTAGAGGTAGG - Intergenic
984410292 4:179389416-179389438 TTGCTGGGTGATATAGAGGTTGG - Intergenic
984741924 4:183173221-183173243 TTCTTTGTTTTTGTAGAGGTGGG + Intronic
987912679 5:24169486-24169508 TTCCTTGGTAATAAAGACATAGG + Intronic
988916805 5:35902694-35902716 ATCTCTGCTCATATAGAGGTTGG - Intergenic
989572940 5:42961940-42961962 ATCTTAGTTAATAAAGAGGTGGG - Intergenic
989703376 5:44297795-44297817 TTTTTTGTTAATATGAAGGTTGG + Intergenic
989790463 5:45393128-45393150 TTCTTTGGTCATATTCAAGTTGG + Intronic
992374869 5:76178516-76178538 TTCCTTAGTAAAATAAAGGTGGG - Intronic
992535327 5:77695910-77695932 TTATTTGGTAAAATGGAAGTTGG + Intronic
993085586 5:83359441-83359463 TTCTCTGGTAATTTATAGATTGG - Intergenic
995461470 5:112408004-112408026 TTCCTTGGTAAGGTAGATGTGGG - Intronic
995487678 5:112655750-112655772 TTTTTTTTTAATATAGAGATGGG - Intergenic
995796677 5:115948584-115948606 TTATTTGGCAATATTGAGTTTGG + Intergenic
996261552 5:121476847-121476869 TTATTTAGTAAAATAGATGTAGG - Intergenic
996868797 5:128162071-128162093 TACTTTGTTAAAGTAGAGGTGGG + Intronic
996901663 5:128549054-128549076 TTCGTTGGTAATAGATAGGAAGG - Intronic
997945894 5:138201033-138201055 TTCTGTAGTAATATAGGGGTGGG - Intronic
1000900396 5:166905146-166905168 TTCTTTGGTCATGTGGAGATAGG - Intergenic
1001113742 5:168921496-168921518 GTCTTTGCTGATATAGAGGAAGG + Intronic
1004290939 6:14366586-14366608 TTCTTTTTTTATTTAGAGGTGGG - Intergenic
1004475836 6:15970266-15970288 TTCTCTGGTTAAATAGAGGTAGG - Intergenic
1009409430 6:63348760-63348782 TGCTTTTTTAAAATAGAGGTGGG + Intergenic
1009814340 6:68711309-68711331 TTCTTTGTAAAAATAGAGATTGG - Intronic
1012675862 6:102112122-102112144 TCCTTTGGTAATCTAGAGAGTGG + Intergenic
1013890753 6:115023709-115023731 TCCCTTGGTAATATGGAGGATGG + Intergenic
1015012604 6:128369194-128369216 TTCTTCAGGAATATAGAAGTGGG - Intronic
1017163523 6:151388540-151388562 TTCTTTTTTAATAGAGATGTGGG + Intronic
1018362513 6:163086466-163086488 TTCTATGGTTATATTTAGGTTGG + Intronic
1018565175 6:165144129-165144151 CTCTTTGGTAGTCTAGAGGTAGG + Intergenic
1020723283 7:11776479-11776501 TTATTTGCTAATAGAGAGGGTGG + Intronic
1023360116 7:39406930-39406952 AACTTTGGCAATCTAGAGGTAGG - Intronic
1025954750 7:66174218-66174240 TTATTTTGTTATATAGAGATGGG + Intergenic
1027518633 7:79174662-79174684 TTTTTTATTAATATAGAGATGGG - Intronic
1028412026 7:90540239-90540261 TTCTATGGTAATAGAAAGGAAGG - Intronic
1028649254 7:93132361-93132383 TTCTTGGGTGAAATAGAAGTTGG - Exonic
1028965936 7:96801237-96801259 TTCTTACGTAATATAAAAGTAGG - Intergenic
1029538906 7:101171783-101171805 TTCTTTGGAAAAACAGAGGGTGG + Exonic
1031327266 7:120417234-120417256 TTCTGTGATAACATAGAGTTAGG - Intronic
1032732127 7:134654067-134654089 TTCATTAGTAAAAGAGAGGTGGG - Intronic
1032803265 7:135333494-135333516 TTCTTTGTCCATAAAGAGGTAGG + Intergenic
1038452835 8:27650894-27650916 TTCTTTTTTAAAATAGAGATGGG + Intronic
1039098756 8:33916748-33916770 TTCTATGGTAGTATAGTGCTTGG + Intergenic
1040002014 8:42585321-42585343 TTCTTTGTTTATTTAGAGATAGG + Intergenic
1041339999 8:56834979-56835001 TTCTTTGGTCATTGAGAGGTAGG + Intergenic
1043486965 8:80707337-80707359 TTCCTTTATAATATAGAGGTGGG + Intronic
1044361480 8:91289857-91289879 TTCTTTGGTAATATAGAGGTAGG - Intronic
1044879023 8:96703129-96703151 TTCTTGGGAAATACAGAGTTAGG - Intronic
1048246505 8:132808880-132808902 TTATTTTTTAATATAGAGATGGG + Intronic
1050774176 9:9239311-9239333 TTTTTTGGTCATATAAAAGTAGG + Intronic
1051985103 9:23075559-23075581 TTATTTGGTAAAATAAAGTTTGG - Intergenic
1052536563 9:29755344-29755366 TTCTTAGTTAAGAAAGAGGTTGG + Intergenic
1053471821 9:38352073-38352095 TTCTTTGGTAATTTAGAATTGGG + Intergenic
1055465635 9:76563148-76563170 TTCTTTTTTAAAATAGAGATAGG + Intergenic
1061770479 9:132916351-132916373 TTCTTTAGAACTATAGAGGCAGG - Intronic
1061821589 9:133230545-133230567 TTCCTTGGTAATTTAGATCTGGG - Intergenic
1062237661 9:135519507-135519529 TTCCTTGGTAATTTAGATCTGGG + Intergenic
1186752931 X:12640460-12640482 TTCTTTTTCAATCTAGAGGTGGG - Intronic
1186841638 X:13490137-13490159 TTCTTTTGGAAGATGGAGGTGGG - Intergenic
1187063536 X:15811025-15811047 TCCTTTTGTATTTTAGAGGTGGG + Intronic
1187342131 X:18430749-18430771 TTGTGTGCTAATACAGAGGTTGG + Intronic
1187439917 X:19308926-19308948 TTATTTGTTAATATTGAAGTTGG - Intergenic
1189275377 X:39781486-39781508 TTTTTTTTTAATATAGAGATGGG + Intergenic
1193093698 X:77523831-77523853 TTTTTTGTTAATATAGTGGTTGG - Intronic
1194627220 X:96239672-96239694 TTCATAGGAAATACAGAGGTGGG + Intergenic
1194694083 X:97023914-97023936 TTCTTTGGTAATATTGAAGCAGG - Intronic
1194801614 X:98280532-98280554 TTGTTTGGGAAGATAGAGATTGG + Intergenic
1196901966 X:120392644-120392666 TTCTTTTATGATATAGAGATGGG - Intergenic
1197574085 X:128186836-128186858 CTCTTTGGCAATATACAGTTGGG + Intergenic