ID: 1044362538

View in Genome Browser
Species Human (GRCh38)
Location 8:91305022-91305044
Sequence ATTCAGAAGCCCTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044362538 Original CRISPR ATTCAGAAGCCCTATGAGGT AGG (reversed) Intronic
901649222 1:10733862-10733884 CTTCAGCAGCCCTGTGAGGCAGG - Intronic
902985899 1:20153934-20153956 TCTCAGCAGCCCTAGGAGGTGGG + Intergenic
905531934 1:38686946-38686968 ATTCAGAGGCACTATAGGGTGGG - Intergenic
905792195 1:40795938-40795960 TTCCAAGAGCCCTATGAGGTAGG + Intronic
906170979 1:43724968-43724990 AGTCAGAAGTCCTCTAAGGTGGG + Intronic
906799781 1:48726560-48726582 ATCCACACGGCCTATGAGGTAGG + Intronic
907741050 1:57166143-57166165 CATCAATAGCCCTATGAGGTAGG + Intronic
911693753 1:100864082-100864104 ATTTAGAATCCCTATGACTTTGG + Intergenic
911857098 1:102892574-102892596 ATGCAGCAGCTCTATGAGATAGG - Intronic
913444054 1:118930927-118930949 TTACAGGAACCCTATGAGGTTGG - Intronic
915177024 1:154024369-154024391 CCACAAAAGCCCTATGAGGTAGG - Intronic
916933902 1:169607886-169607908 ATTCAGAAGGCCTATGAAGGGGG + Intronic
917580817 1:176376168-176376190 TTTCAGGAGCCCTAGGAGGATGG + Intergenic
917855679 1:179097426-179097448 ATCCAGCAACCCTGTGAGGTAGG - Intronic
919080551 1:192860644-192860666 CCTAAGAGGCCCTATGAGGTAGG + Intergenic
920355698 1:205370622-205370644 ATTCAGAAGTCAGATGAGGCCGG - Intergenic
920391110 1:205602448-205602470 TTTCAGAATTCCTTTGAGGTAGG - Exonic
923981012 1:239323983-239324005 ATTCTGTAGCCCTATGAGATTGG + Intergenic
924518277 1:244783909-244783931 CTTCAGTAGTCCTATGAAGTAGG - Intergenic
924807274 1:247371556-247371578 ATCCAGAAGCCCTAGAATGTGGG + Intergenic
1065672793 10:28139632-28139654 ATTGTGAAGCCCTATTAAGTAGG - Intronic
1066304259 10:34124902-34124924 GCTCAGAAGCCCTGTGTGGTAGG - Intronic
1072297763 10:94027921-94027943 AGTCTGAAGCCCTATGGGTTTGG - Intronic
1072678509 10:97487652-97487674 ATTCAGAAGCCCTAAAAGATTGG + Intronic
1074120640 10:110491789-110491811 TCTCATCAGCCCTATGAGGTAGG + Intergenic
1075490436 10:122863279-122863301 CTTAAGAGACCCTATGAGGTAGG + Intronic
1076116668 10:127906272-127906294 ATTCATAAGCCTAATGAGCTGGG + Intergenic
1076126047 10:127974890-127974912 TTTCAGCTGCCCTATGAGGTGGG - Intronic
1078907023 11:15697142-15697164 GTTCTGAAGCCCTATGACTTGGG - Intergenic
1080087800 11:28306406-28306428 ATTCAGAAGCCTTAAGAATTTGG + Intronic
1080519304 11:33053048-33053070 AATCAGAAACCCTGAGAGGTGGG + Intronic
1080777894 11:35403171-35403193 ATTCCAAAACCCTATCAGGTGGG + Intronic
1083077912 11:60060586-60060608 ATTTATAAGCCATATGAGTTTGG + Intronic
1083326063 11:61873635-61873657 ATTCAGCAGCCCTATGGCCTTGG - Exonic
1083713883 11:64564852-64564874 ATCGAGAACCCCCATGAGGTGGG - Intronic
1083730800 11:64651524-64651546 ACTCAGATGCCCGATGAAGTTGG + Exonic
1085550054 11:77360836-77360858 ATTCAGTGGCCTTCTGAGGTAGG - Intronic
1086859094 11:91903279-91903301 ATACAGAAGCTCTATAAGTTAGG + Intergenic
1089801624 11:121035236-121035258 CTTCAGTAACCCTATGAGCTAGG + Intronic
1090331171 11:125933285-125933307 AATCAGAAGCCCTTGGGGGTGGG + Intergenic
1094268254 12:28583229-28583251 TTTCAACAACCCTATGAGGTGGG + Intergenic
1095532069 12:43200249-43200271 ACTCAGCAACCCTATGAGGAAGG - Intergenic
1096477694 12:51918420-51918442 TCACAGCAGCCCTATGAGGTAGG - Intronic
1097800836 12:63912219-63912241 GTACAAAAGCCCTGTGAGGTAGG + Intronic
1098187174 12:67909921-67909943 ATTGGGAAGCCCTATATGGTTGG + Intergenic
1098601993 12:72342954-72342976 ATTCTAACGTCCTATGAGGTGGG + Intronic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101320262 12:103667363-103667385 ATGCAGCAGCCCCACGAGGTGGG + Intronic
1102126474 12:110486100-110486122 ATTCAGATGCCCTTTGAAGTCGG - Intronic
1102719733 12:115005716-115005738 TTTCAGAACCCCCATGGGGTCGG + Intergenic
1103150226 12:118631702-118631724 ATTCAGAAGGCCTTTGAGGAGGG - Intergenic
1106012542 13:25838487-25838509 ATTCAAAGGCCATTTGAGGTGGG + Intronic
1106710981 13:32332592-32332614 AATCAGAAGCCCTTTGAGAGTGG + Exonic
1107271976 13:38630413-38630435 ATCCAGAAGACCTAGAAGGTGGG - Intergenic
1108094137 13:46882561-46882583 ATTCAGAAGCCATAAGAGAAAGG + Intronic
1108291239 13:48963561-48963583 TTTCAGAAGGCCTATGAACTTGG - Intergenic
1108407077 13:50115342-50115364 GTACAGAAGGCCTATGAGGGAGG - Intronic
1113332757 13:109346358-109346380 ATTGAGAAGTCCTATCAGGCAGG - Intergenic
1115449717 14:33532541-33532563 ATTTATGAGCCCTATGAGCTTGG - Intronic
1115876947 14:37871614-37871636 TTTCAGTAGCTCTGTGAGGTGGG + Intronic
1117804969 14:59482139-59482161 ACTCAGCAACCCTCTGAGGTGGG + Intronic
1118434584 14:65757927-65757949 TTACAAAAACCCTATGAGGTGGG - Intergenic
1119749576 14:77067865-77067887 TTTCACAAACTCTATGAGGTAGG + Intergenic
1122878703 14:104680339-104680361 GTCCAGCAGCCCTAGGAGGTGGG + Intergenic
1123154311 14:106209803-106209825 ACTCAGAACCCATATGATGTGGG - Intergenic
1123405928 15:20019426-20019448 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1123515258 15:21026074-21026096 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1127555764 15:60085850-60085872 ATTCATATGCTCTATCAGGTGGG + Intergenic
1128091595 15:64922567-64922589 ATTCAGAGGACCTATGAACTTGG + Intronic
1128661521 15:69504660-69504682 ATTCAAAAGCCATTTGAGGGGGG + Intergenic
1130293234 15:82623017-82623039 AATGAGAATCCCTAAGAGGTGGG - Intronic
1133170652 16:3980772-3980794 ATACAGAGGCCCTAGGAGGGGGG + Intronic
1134409647 16:13993354-13993376 TTTCCAAACCCCTATGAGGTAGG - Intergenic
1134439492 16:14289800-14289822 CTTCAGAAGTCCTGTTAGGTTGG - Intergenic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1136003094 16:27311198-27311220 ATTTCATAGCCCTATGAGGTGGG + Intergenic
1136707249 16:32200837-32200859 AGTCAGAGGCCCTGGGAGGTGGG + Intergenic
1136760661 16:32728580-32728602 AGTCAGAGGCCCTGGGAGGTGGG - Intergenic
1136807442 16:33141806-33141828 AGTCAGAGGCCCTGGGAGGTGGG + Intergenic
1137726803 16:50662191-50662213 TTACAGTGGCCCTATGAGGTAGG - Intergenic
1140233092 16:73134067-73134089 CCCCAGTAGCCCTATGAGGTAGG + Intronic
1141365818 16:83441911-83441933 ATACAACATCCCTATGAGGTAGG + Intronic
1142352221 16:89585759-89585781 ATGCAGAAGGCCTTTGAGGAGGG + Exonic
1203062813 16_KI270728v1_random:988894-988916 AGTCAGAGGCCCTGGGAGGTGGG - Intergenic
1142630429 17:1222363-1222385 ATTAAGAAGCCATTTGAGGCCGG - Intronic
1144721419 17:17473096-17473118 TTTCAGCAGCCCCATTAGGTAGG + Intergenic
1146551603 17:33785037-33785059 ATTCTGAAGCCCTGGGAGTTAGG - Intronic
1147459959 17:40562015-40562037 TCTCAAAAGCCCCATGAGGTAGG + Intronic
1147623715 17:41885658-41885680 CTCCAGTAGCCCCATGAGGTGGG + Intronic
1151158094 17:72141414-72141436 TCGCAGCAGCCCTATGAGGTAGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153276303 18:3371313-3371335 TCACAGAAGTCCTATGAGGTAGG - Intergenic
1153537278 18:6115869-6115891 ATACAGATGCCCTGGGAGGTGGG + Intronic
1154982277 18:21513072-21513094 ATACAGCAACCCTATGAGATCGG + Intronic
1158201366 18:54945302-54945324 AATAAAAAGCCCTGTGAGGTAGG + Intronic
1158206488 18:54999420-54999442 TTACAGAAGGCCTATGAGATGGG - Intergenic
1160041782 18:75352143-75352165 ATTCATATGGCCCATGAGGTAGG + Intergenic
1160102172 18:75933269-75933291 AATCAGAAGTCCTCTGAGATTGG - Intergenic
1161747030 19:6066964-6066986 TTTCAGAAGCCCTAAGAGAAAGG + Intronic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1165706852 19:37982500-37982522 TCGCAGTAGCCCTATGAGGTGGG + Intronic
1165833425 19:38740848-38740870 ATACAGAAGCCCTTGGAGATTGG + Intronic
1166889377 19:45981185-45981207 ACGCAGGAGCCCTCTGAGGTGGG - Intergenic
1168588891 19:57616510-57616532 AAACAGTAGCCCTATGAGGTGGG + Intronic
926645111 2:15282536-15282558 ATTCAGAGTCCCTATGACCTGGG + Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927422889 2:22951660-22951682 TCTCAATAGCCCTATGAGGTTGG + Intergenic
928264581 2:29800797-29800819 ACTCAGAAGCCCCATGCGTTGGG - Intronic
930492215 2:52089652-52089674 ATTCTGAAGCTGTATGAGTTGGG + Intergenic
931683399 2:64771297-64771319 TTACAGCAGCCCTATGAGGGAGG - Intergenic
935311635 2:101789420-101789442 ACACAGAAGCCCTATGAAGTGGG + Intronic
935720031 2:105971820-105971842 ATGCAGAAGCCCACTGAGCTGGG + Intergenic
936582609 2:113716519-113716541 AGACAGGAGGCCTATGAGGTGGG + Intronic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
939546682 2:143563439-143563461 ATTCAGAAGGCCTATGAATTTGG - Intronic
942776194 2:179585330-179585352 ATTCAGAAATTCCATGAGGTAGG - Intronic
946236298 2:218326535-218326557 TCACAGGAGCCCTATGAGGTAGG - Intronic
946770665 2:223085405-223085427 AATCAGAAGCCCTATAGGGCTGG - Intronic
947241268 2:227996942-227996964 ATCCAGAAGCCCAGTGAGATTGG + Intronic
947990872 2:234486489-234486511 TCTCTGAAGCACTATGAGGTAGG - Intergenic
949072244 2:242032822-242032844 CCTCAGAGGCCCTATGAGGCAGG - Intergenic
1169138523 20:3212824-3212846 ATTCAGAAGGCCTATGAACATGG - Intronic
1169466468 20:5845288-5845310 TTACAAGAGCCCTATGAGGTAGG + Intronic
1170111310 20:12807076-12807098 ATTAAGAAGCCACATGTGGTTGG - Intergenic
1172154142 20:32811720-32811742 CTTCAGTAACCCTATGAAGTAGG - Intergenic
1173212409 20:41045533-41045555 TCTCAGCAACCCTATGAGGTAGG + Intronic
1174311025 20:49654808-49654830 ATTAAGAAGCCATAGGAGGCTGG + Intronic
1175525047 20:59628093-59628115 ATGCCGAAGCCTTAAGAGGTTGG - Intronic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1180886064 22:19244761-19244783 ACTCAGCAGCCCCATGAGGTGGG - Intronic
1181627640 22:24132488-24132510 ATTCAGAAGCCTCTTGAGGCTGG - Intronic
1182520832 22:30883720-30883742 TTACAGAAGCCCCATGAGTTGGG - Intronic
949143490 3:664957-664979 GTGCAGATGCCCTATGAGGATGG - Intergenic
949683678 3:6543906-6543928 ATTAAGAATACCAATGAGGTTGG - Intergenic
949779215 3:7666999-7667021 TCTCAGCAGACCTATGAGGTTGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950979505 3:17287605-17287627 AATCAACAACCCTATGAGGTAGG - Intronic
953977774 3:47395290-47395312 CTTAAGGAGCCCTGTGAGGTGGG + Intronic
954519908 3:51215622-51215644 ATAGAGAAGGCCTATGTGGTGGG + Intronic
955681844 3:61509608-61509630 ATTCAGAAAATCTGTGAGGTGGG - Intergenic
955778098 3:62455133-62455155 GTTCAGAAGCCCCAGGGGGTGGG - Intronic
955846997 3:63174991-63175013 ATTCAGGAGGCTTGTGAGGTAGG + Intergenic
956527548 3:70181559-70181581 GTTCAACAACCCTATGAGGTGGG - Intergenic
958858532 3:99417016-99417038 ACTCAGAAGCCATATGACCTTGG + Intergenic
961001522 3:123377329-123377351 ATGCAGAAGCCCTGTTAGGATGG - Intronic
961038371 3:123659551-123659573 AGTCAGAAGTCCTAGGAGATTGG + Intronic
963925474 3:150946250-150946272 TCTCAACAGCCCTATGAGGTAGG + Intronic
965441969 3:168725406-168725428 TTTATGAAACCCTATGAGGTGGG + Intergenic
967284787 3:187858543-187858565 TTTCATCAGCCCAATGAGGTGGG + Intergenic
970213614 4:13736051-13736073 TTTCAGCAACCTTATGAGGTAGG + Intergenic
970657213 4:18244645-18244667 ATTTAACAACCCTATGAGGTAGG + Intergenic
971468016 4:26986175-26986197 ACTCAAAAACCCTATGAAGTAGG - Intronic
972161617 4:36234683-36234705 TCACAGTAGCCCTATGAGGTAGG - Intronic
974977573 4:68909525-68909547 TTTCAGCAACCCCATGAGGTCGG + Intergenic
975789391 4:77932359-77932381 ATTCAGGAGCCTTTTGTGGTTGG - Intronic
976175025 4:82343163-82343185 ACACAGAAGCCCTATGATTTTGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979806521 4:124979442-124979464 TTGCAGAAACCCTGTGAGGTAGG - Intergenic
982750343 4:159153308-159153330 AATCAGAATCCCTCTCAGGTGGG - Intronic
989462726 5:41719460-41719482 TTTCAGCAGCCCTGTGAGGAAGG + Intergenic
990108567 5:52294193-52294215 ATTCTGCAGCCCTGTGAGGAAGG - Intergenic
995042659 5:107606706-107606728 ATTTTGTAGCCCTATGAGGCAGG - Intronic
996058446 5:119006258-119006280 ATTCATAAGCACAATGATGTAGG + Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998229935 5:140354630-140354652 ATAGTGAAGCCCTCTGAGGTAGG - Intergenic
998960493 5:147481265-147481287 TTACAGCAGCCCTATGAGGTAGG - Intronic
999307729 5:150531258-150531280 TTACAGCAGCCCTGTGAGGTGGG + Intronic
999994392 5:157078326-157078348 ATACAGAGGCTCTATTAGGTTGG + Intergenic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1001746412 5:174096089-174096111 TTACAACAGCCCTATGAGGTAGG - Intronic
1003923686 6:10856891-10856913 ATTCATAAGCCCAATGATGCAGG - Intronic
1003953796 6:11143573-11143595 TTACAAAAGCCCTATGAGATAGG - Intergenic
1006807209 6:36796451-36796473 ATGGAGATGCCCTATGAGGGAGG - Intronic
1008966879 6:57321772-57321794 ATACAGCAGTCTTATGAGGTGGG + Intronic
1010069000 6:71721087-71721109 ATTCTGAAGTACTATGAGTTAGG + Intergenic
1013002080 6:106032983-106033005 TCACAAAAGCCCTATGAGGTGGG + Intergenic
1013653406 6:112219781-112219803 CCACAGTAGCCCTATGAGGTAGG + Intronic
1014139700 6:117927108-117927130 CTTCAGTATCCCTATGAGGTAGG - Intronic
1014186973 6:118445785-118445807 ATTCAGCAGCCCTGTGCTGTAGG - Intergenic
1017073616 6:150598990-150599012 ATACAGCAACTCTATGAGGTAGG + Intergenic
1022606115 7:31815768-31815790 ATCCTGCAGCCCAATGAGGTGGG + Intronic
1022995685 7:35753016-35753038 TCACAGAAGCCCTATGAGGTCGG - Intergenic
1024213481 7:47227340-47227362 ATGGAGATGCCCTAGGAGGTGGG - Intergenic
1025156849 7:56614637-56614659 ATTCAGCACACCTGTGAGGTTGG - Intergenic
1030571513 7:111230987-111231009 GTACAGAAGCCCTATGATGTAGG + Intronic
1036653067 8:10658131-10658153 TTTCAAAAACCCTAGGAGGTAGG + Intronic
1037488911 8:19377832-19377854 AATCAGAACTCCTAGGAGGTAGG + Intronic
1037918779 8:22789504-22789526 ATTCCTAAGCCCCCTGAGGTGGG + Intronic
1038966648 8:32580536-32580558 TTTTAGTAGCCCTATGAGATAGG + Intronic
1039291491 8:36098799-36098821 ATTCAGTAGCCACATGTGGTTGG + Intergenic
1039775053 8:40727356-40727378 ATGCAGAAGCCAACTGAGGTGGG - Intronic
1039954381 8:42195861-42195883 ATTCACAATTCCTGTGAGGTGGG - Intronic
1041731572 8:61068498-61068520 ATTCATCAGCCCTAAGGGGTAGG - Intronic
1042182369 8:66103999-66104021 ACACAGCAACCCTATGAGGTAGG + Intergenic
1043823507 8:84897132-84897154 TTACAAAAGCCCCATGAGGTGGG - Intronic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1044587718 8:93883568-93883590 TCTCAGAAGCCCTAGGAGGTAGG + Intronic
1044693471 8:94900606-94900628 ATCCAGAAGCTCTGGGAGGTTGG + Intronic
1044737486 8:95294239-95294261 TCTCAACAGCCCTATGAGGTAGG + Intergenic
1045561168 8:103264550-103264572 TTGCAGTAGCCCTATGATGTGGG - Intergenic
1045576964 8:103433332-103433354 TTTCAGTATCCATATGAGGTAGG + Intronic
1045814435 8:106262840-106262862 TTTCAGCAGCCCGAGGAGGTTGG - Intergenic
1045832112 8:106475039-106475061 TTACAGAAATCCTATGAGGTAGG - Intronic
1047777689 8:128087109-128087131 CTTCAATAGCCCTCTGAGGTAGG + Intergenic
1048911165 8:139136534-139136556 ATTCAAGAGCTCTATTAGGTTGG - Intergenic
1049248221 8:141574213-141574235 ACTCAGGAGCCCTCTGAGCTGGG + Intergenic
1051450434 9:17192209-17192231 TTGCAGTAGCCCTCTGAGGTAGG + Intronic
1051900970 9:22039819-22039841 ATTCTGAAGCACTAGGAGTTAGG - Intergenic
1054871891 9:70054725-70054747 ATTCAGAAACCCTAAGAGCCTGG + Intronic
1056162001 9:83905767-83905789 AATCAGAATCCCTGTGAAGTAGG + Intronic
1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG + Intergenic
1056358324 9:85825695-85825717 AATCAGAATCCCTGTGAAGTAGG - Intergenic
1059456878 9:114405436-114405458 TCCCAGTAGCCCTATGAGGTTGG - Intronic
1059721531 9:116964665-116964687 ATTCAAGGGCCCTATGATGTGGG + Intronic
1060706611 9:125807609-125807631 ACTCAACAGCCCTATGAGGTAGG - Intronic
1061130988 9:128707597-128707619 ACACAGCAACCCTATGAGGTAGG - Intronic
1187406052 X:19004975-19004997 ATTCAACAAACCTATGAGGTAGG + Intronic
1187657194 X:21489865-21489887 ATTCTGAATCCCTCTGAGGCAGG - Intronic
1187741398 X:22359796-22359818 ATTCAGTAGCACTATGATATTGG - Intergenic
1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG + Intergenic
1198962016 X:142193363-142193385 GTTCAGAAGCCATATCAGGAAGG - Intergenic
1199546068 X:149008389-149008411 ATTCTGAAGTACTATGAGTTAGG - Intergenic
1199602923 X:149553589-149553611 ATCCTGAACTCCTATGAGGTTGG + Intergenic
1199647466 X:149925886-149925908 ATCCTGAACTCCTATGAGGTTGG - Intergenic
1199799237 X:151232974-151232996 TCTCAGGAGCCCTGTGAGGTAGG - Intergenic
1199903192 X:152198138-152198160 TCACAGGAGCCCTATGAGGTAGG + Intronic
1201556128 Y:15266052-15266074 ATACAAAAACCCTAGGAGGTGGG + Intergenic