ID: 1044366508

View in Genome Browser
Species Human (GRCh38)
Location 8:91353570-91353592
Sequence TGGATTGCTCTTGCATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044366508_1044366510 1 Left 1044366508 8:91353570-91353592 CCTATCTATGCAAGAGCAATCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1044366510 8:91353594-91353616 AATTCTCTCCCTCTCCAATATGG No data
1044366508_1044366511 2 Left 1044366508 8:91353570-91353592 CCTATCTATGCAAGAGCAATCCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1044366511 8:91353595-91353617 ATTCTCTCCCTCTCCAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044366508 Original CRISPR TGGATTGCTCTTGCATAGAT AGG (reversed) Intronic
900650139 1:3726466-3726488 TGGATTGATATTGAATGGATGGG + Intronic
902577920 1:17389975-17389997 TGGAATGCTCTAGCAGGGATGGG + Intronic
904661256 1:32086976-32086998 AGGATTGCTCCTGAATAGCTGGG + Intronic
906074481 1:43041959-43041981 TGGACTGCTGTGGCTTAGATGGG + Intergenic
907746028 1:57214490-57214512 TGGATGGCTCTTGCTTATACTGG - Intronic
911607953 1:99929514-99929536 TGGTTTGTTCTTCCTTAGATTGG - Intergenic
913428838 1:118766335-118766357 TGGATTGGGATAGCATAGATAGG + Intergenic
916544627 1:165792070-165792092 TGGATTCATGTTGCATATATTGG + Intronic
917524041 1:175771461-175771483 TGGATTGCTCTTGCTTAGGGAGG - Intergenic
922360146 1:224813746-224813768 TAGATTGCTTTTGCATAGTAGGG - Intergenic
1075126168 10:119701419-119701441 TGTATTTCTCTTGCATAAAGAGG + Intergenic
1078624713 11:12944205-12944227 TGGGTTCCTCTTGGGTAGATTGG + Intronic
1078745042 11:14105274-14105296 TGGAGTGCTCTGGAAGAGATAGG - Intronic
1080109909 11:28555008-28555030 TGGATCCCTCTTGAATAGCTTGG + Intergenic
1089980638 11:122769306-122769328 TGGATTGCTCATGAATGGCTTGG - Intronic
1090562839 11:127951213-127951235 TGCATTACTCTTTCATAGATAGG + Intergenic
1093444414 12:19239832-19239854 GGGATTGATCTTGCTTAGAAAGG - Intronic
1094105836 12:26810563-26810585 TGGAATGCTCATGCAGAGACTGG - Intronic
1094474744 12:30832573-30832595 AGGATTGCTCTTGCTCAGAATGG - Intergenic
1096729815 12:53600126-53600148 TGGATTCGTCTTTCCTAGATAGG + Intronic
1104681870 12:130757682-130757704 TGGATTCCTCATGCATGGCTTGG + Intergenic
1105604497 13:21915698-21915720 TGGATGGATGTTGGATAGATAGG - Intergenic
1106563600 13:30867249-30867271 TGAATTGCTCTTGCAGTGAAAGG - Intergenic
1108656960 13:52543031-52543053 TGAATTGCTGTTGAGTAGATTGG + Intergenic
1110896844 13:80763482-80763504 TAGATAGATATTGCATAGATAGG - Intergenic
1111998723 13:95190784-95190806 TGAATTTCTCGTGGATAGATTGG + Intronic
1114318808 14:21529775-21529797 TTGGTTGCTTTTGCAGAGATGGG - Intronic
1114402407 14:22422004-22422026 TGGATTGCTCTTTAACACATGGG + Intergenic
1115386235 14:32800841-32800863 TGTATTTTTTTTGCATAGATGGG - Intronic
1115895669 14:38084280-38084302 TGGATTGCTCATGAATGGCTTGG + Intergenic
1117433504 14:55694657-55694679 TGTAATGTTCTTGCATACATGGG + Intronic
1118248207 14:64132618-64132640 GGGATTTCTCATACATAGATTGG + Intronic
1128172645 15:65526425-65526447 TAGATTTCTCTTGCAGAGAGGGG + Intergenic
1132360921 15:101214644-101214666 TGGATTTCTCATGCATAGGTGGG + Intronic
1132360930 15:101214687-101214709 TGGATTTCTCATGCATAGGTGGG + Intronic
1132360939 15:101214730-101214752 TGGATTTCTCATGCATAGGTGGG + Intronic
1132360948 15:101214773-101214795 TGGATTTCTCATGCATAGGTGGG + Intronic
1132360957 15:101214816-101214838 TGGATTTCTCATGCATAGGTGGG + Intronic
1132360966 15:101214859-101214881 TGGATTTCTCATGCATAGGTGGG + Intronic
1138683215 16:58701961-58701983 TGGATTCCTCTTGAATGGCTTGG + Intergenic
1139216804 16:65133546-65133568 TAGATGTCTCTTGCAGAGATGGG - Intergenic
1141192537 16:81834867-81834889 TGGATTCCTCTTGGGTGGATGGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1145335332 17:21907635-21907657 TGGAATGCTATTGCAGAGAACGG + Intergenic
1148941255 17:51213811-51213833 TTGATTGTTCTGGCAGAGATGGG - Intronic
1203180027 17_KI270729v1_random:49426-49448 TGGAATGGACTTGAATAGATTGG + Intergenic
1154969986 18:21398279-21398301 TAGATTGCTCATGCATATAATGG + Intronic
1155084239 18:22440898-22440920 TGGATTCCTCATGAATAGCTTGG - Intergenic
1155375915 18:25157567-25157589 TGGATTGCTTAAGCAAAGATGGG + Intronic
1158763622 18:60421441-60421463 TGGTTTGCTTTTGCTTTGATTGG - Intergenic
1159072997 18:63646847-63646869 TGAAATTCTCTTCCATAGATTGG - Intronic
1161287587 19:3476959-3476981 TGGATGGCTGATGGATAGATGGG + Intronic
1165098323 19:33422575-33422597 TGGATTGCACTTAGGTAGATAGG - Intronic
928376004 2:30774632-30774654 TGGATAGCTATTGAATACATTGG + Intronic
928872894 2:36001712-36001734 TGGTTTTCTCCTGCATAAATAGG + Intergenic
929295570 2:40242671-40242693 TGGTTTGCTTCTGCCTAGATGGG - Intronic
930280705 2:49366338-49366360 TTGATTGGAATTGCATAGATAGG - Intergenic
931225717 2:60328219-60328241 TGGATTGACCTTGAACAGATGGG - Intergenic
933338386 2:80989328-80989350 TGGTTTGCTCTTGCATTTCTTGG - Intergenic
940344270 2:152613055-152613077 TGGGCTGCCCTTGAATAGATGGG + Intronic
943266147 2:185735718-185735740 TGGTTTGCACTTGCTTAGCTAGG - Intergenic
943819914 2:192307665-192307687 TGGATAACTCTTCCATAGAGAGG + Intergenic
943902560 2:193459349-193459371 AGGATTGTTCTTTCATAGACAGG + Intergenic
946701761 2:222422091-222422113 TGTATTTCTCTTTCATAGAATGG - Intergenic
946764909 2:223031497-223031519 TGGTTTGTTCTAGCATAGAGGGG - Intergenic
947888136 2:233592528-233592550 AGCATTGCTCTTGCAGGGATGGG - Intergenic
947894365 2:233655758-233655780 AGCATTGCTCTTGCAGGGATGGG - Intronic
947912785 2:233812206-233812228 TGGGCTGCTCTTCCATTGATTGG + Intronic
948063469 2:235059138-235059160 TGCATTTCTATTGCAGAGATAGG - Intergenic
1169172212 20:3473905-3473927 TGGTTTGCTCTTGGAAAGGTGGG + Intronic
1169210832 20:3765536-3765558 GGGTTTGCTTTTGCAGAGATGGG - Intronic
1174109411 20:48187842-48187864 TGCAATGCTCTGGAATAGATAGG - Intergenic
1180283356 22:10722675-10722697 TGGAATGCACTTGAATAGAATGG - Intergenic
1181157662 22:20934176-20934198 TGGATTGCTTTCGCAAAGACAGG - Exonic
1182931576 22:34179411-34179433 TGAAGTGCACTTGCATAGTTGGG - Intergenic
1203304661 22_KI270736v1_random:100846-100868 TGGAATGCTCTGGTATAGAGTGG + Intergenic
949595054 3:5534317-5534339 TGGATTGCTCTTTTGTAGGTAGG + Intergenic
952147818 3:30552268-30552290 TGTATTCCTCATGCATACATTGG - Intergenic
952535209 3:34302161-34302183 GGAATTGCTGTTTCATAGATTGG + Intergenic
955118615 3:56031961-56031983 TGGATTCCTCTTGAATGGCTTGG + Intronic
956485698 3:69720095-69720117 GTGATAGCTCTTGCAAAGATTGG - Intergenic
957703280 3:83746865-83746887 TTGCTTTCTCTTGCATAAATTGG + Intergenic
965223331 3:165955428-165955450 GGCATTGCTAATGCATAGATGGG - Intergenic
970254499 4:14153712-14153734 TAGATTACTATTGCATACATGGG + Intergenic
970894963 4:21091796-21091818 TGGAGTGCTCATGAATGGATTGG - Intronic
971389847 4:26175602-26175624 TGGAATGATCGTGCCTAGATGGG + Intronic
971431478 4:26572548-26572570 TGGATTTCTATTGCATAGTAAGG + Intergenic
975183994 4:71379884-71379906 GTGATTCCTCTTGCATAGATTGG + Intronic
975826509 4:78325465-78325487 TGGAATTCTCTTGCATTAATTGG + Intronic
977765252 4:100789942-100789964 TCTATTGCTCTTGCAAAGACAGG + Intronic
981322543 4:143409610-143409632 TGCATTGCTGTAGAATAGATTGG - Intronic
982871898 4:160590145-160590167 TGGATTCCTCATGAATAGCTTGG - Intergenic
984018021 4:174449047-174449069 TTCCTTGCTTTTGCATAGATTGG + Intergenic
984203452 4:176756499-176756521 TGGAATGTTCTTCCCTAGATGGG - Intronic
1202750639 4_GL000008v2_random:2446-2468 TGGAATGCTATGGAATAGATTGG + Intergenic
989289542 5:39747332-39747354 TGGATTTCTCATGAATAGCTTGG - Intergenic
989810704 5:45669707-45669729 TAGATTGATCATGCAAAGATAGG + Intronic
994803827 5:104417176-104417198 TGGATAGCTATTCCATAGCTGGG + Intergenic
996017334 5:118554787-118554809 TGCCTTGTTATTGCATAGATGGG - Intergenic
996120904 5:119671010-119671032 TGGATTTCTCATGAATAGTTTGG + Intergenic
997293664 5:132755811-132755833 TGAAAGGCTCTTGCATAGGTGGG - Intronic
1006666561 6:35698891-35698913 TGGATTTCTCATGCATGGTTTGG - Intronic
1018301980 6:162412828-162412850 TGGATTACTTTTGTATAGATGGG + Intronic
1021270682 7:18581238-18581260 TGGATTGCTGCTGAATAAATTGG + Intronic
1024027616 7:45426418-45426440 TGGATTGCTGTGTCATAGGTAGG - Intergenic
1027643017 7:80760965-80760987 TGGTTTGCTCATGTATATATTGG + Intronic
1028285631 7:88994867-88994889 TGGATTCATTTTGCATAGAGAGG + Intronic
1028965464 7:96796859-96796881 TAGATTGCACCTGCATAAATTGG + Intergenic
1031719215 7:125149372-125149394 TAGTTTTCTCTTGCATAAATAGG + Intergenic
1032895938 7:136250791-136250813 TGGATTCCTCATGAATAGCTTGG + Intergenic
1032962282 7:137050142-137050164 TAGATAGCTCTTGCAGAGAAGGG - Intergenic
1033639111 7:143243623-143243645 AGGATTGTTCTTGAAGAGATAGG - Intergenic
1038339643 8:26674575-26674597 AGGGATTCTCTTGCATAGATGGG - Intergenic
1041765748 8:61416610-61416632 AGGTTTGTTCCTGCATAGATGGG - Intronic
1044366508 8:91353570-91353592 TGGATTGCTCTTGCATAGATAGG - Intronic
1052004829 9:23334287-23334309 TGGAATGCTCCTACATTGATGGG + Intergenic
1058673889 9:107384030-107384052 TGTATAGCTCATGCATAGAATGG - Intergenic
1061083382 9:128385558-128385580 TGGATGGCTCTGTGATAGATAGG - Intronic
1203385729 Un_KI270438v1:48487-48509 TGGAATGCACTTGAATGGATTGG + Intergenic
1203386940 Un_KI270438v1:64692-64714 TGGAATGCACTTGAATAGAATGG + Intergenic
1203342214 Un_KI270442v1:678-700 TGGATTGCACTTGAATGGAGTGG + Intergenic
1188808346 X:34619850-34619872 GAGATTGCTCTGGCATAGCTAGG + Intergenic
1196170584 X:112584125-112584147 TGGATTCCTCATGAACAGATTGG - Intergenic
1200949989 Y:8888008-8888030 TGTCTTGCCCTTTCATAGATTGG + Intergenic
1201130930 Y:10951412-10951434 TGGATTGCTCTGGCATGGAATGG - Intergenic
1201140824 Y:11026641-11026663 TGGATTGCCATTGAATAGAGTGG - Intergenic
1201207155 Y:11643357-11643379 TGGAATGGTCTCGAATAGATTGG + Intergenic