ID: 1044369219

View in Genome Browser
Species Human (GRCh38)
Location 8:91389425-91389447
Sequence CATAAATACCTCAACAAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044369219_1044369221 22 Left 1044369219 8:91389425-91389447 CCATGCTTGTTGAGGTATTTATG 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1044369221 8:91389470-91389492 CTTCCCTTTTGTTCAGTAACAGG 0: 1
1: 0
2: 0
3: 17
4: 162
1044369219_1044369222 23 Left 1044369219 8:91389425-91389447 CCATGCTTGTTGAGGTATTTATG 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1044369222 8:91389471-91389493 TTCCCTTTTGTTCAGTAACAGGG 0: 1
1: 0
2: 1
3: 17
4: 259
1044369219_1044369223 24 Left 1044369219 8:91389425-91389447 CCATGCTTGTTGAGGTATTTATG 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1044369223 8:91389472-91389494 TCCCTTTTGTTCAGTAACAGGGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044369219 Original CRISPR CATAAATACCTCAACAAGCA TGG (reversed) Exonic
900140012 1:1135887-1135909 CATAAAGACCTCAACCAGGCTGG + Intergenic
903442131 1:23396066-23396088 CAGCAATACCTCAACAAGTCTGG - Intronic
903507214 1:23846073-23846095 CATAACTACCTCAACTACAAAGG - Exonic
906246621 1:44280167-44280189 CATAAATACCACAATAAATATGG - Intronic
910783142 1:90963995-90964017 CACAAATACCTTAACAATTATGG + Intronic
911506915 1:98764276-98764298 CTAAAATTCTTCAACAAGCAAGG + Intergenic
912690849 1:111803621-111803643 CATAAATACTTCAGTATGCATGG - Intronic
912988524 1:114459320-114459342 CATAAAAACCTGAAAGAGCAAGG + Intronic
913230643 1:116738115-116738137 TATGAATAACTGAACAAGCAAGG - Intergenic
913551814 1:119923837-119923859 CATCAATACCACAATAACCAGGG + Exonic
914836463 1:151210881-151210903 CATAAATATGTCAATAAGCCCGG - Intronic
914843580 1:151267533-151267555 CATAGAGAACTCAACAAGGAAGG - Intergenic
918026609 1:180755655-180755677 CATAAATACCATAATAAACATGG - Intronic
919678711 1:200411772-200411794 CATAAAAACCTAAAAAAGGACGG + Intergenic
920627579 1:207617949-207617971 CATGAAGACCTCAACCAGCCAGG - Intronic
921508101 1:215998888-215998910 AATAAATATCTCATCAAGCTGGG - Exonic
924910330 1:248504626-248504648 TATAAATTTCTCAACAATCATGG + Intergenic
1063316256 10:5009441-5009463 CCTAGATAGGTCAACAAGCAGGG + Intronic
1064133709 10:12732298-12732320 CCTACAAACCTCAACATGCATGG - Intronic
1068740284 10:60461473-60461495 GATAGGTACATCAACAAGCAGGG + Intronic
1072413558 10:95228484-95228506 CATAGAAAACTCAACAAACACGG - Intronic
1073457393 10:103645864-103645886 CAAAAATAGCTCCACAACCATGG + Intronic
1073820334 10:107255063-107255085 GATAAATAACTCAACAAGCCAGG + Intergenic
1073852764 10:107640265-107640287 CATAAATACATCAAGATCCATGG + Intergenic
1076341242 10:129746684-129746706 CATCAATACTCCAACAAGCTGGG + Intronic
1078838982 11:15060066-15060088 GATAAATATATCAAGAAGCAAGG + Intronic
1083413542 11:62510370-62510392 CATAAATACTTCAGCATGTATGG - Intronic
1086055859 11:82645497-82645519 CAATTATACCTCAACAAACAGGG - Intergenic
1088149853 11:106731345-106731367 GTTAAAAACCTCAACAAGCTAGG + Intronic
1090114905 11:123958751-123958773 TAAAAAACCCTCAACAAGCAAGG - Intergenic
1095309579 12:40682127-40682149 CACAAATATCTCAACACACAAGG - Intergenic
1095845950 12:46744844-46744866 GATAAAAACCTCAACAAACTAGG + Intergenic
1097043241 12:56168988-56169010 CATAAATAAATAAACAAGCATGG + Intronic
1098724206 12:73941821-73941843 GATAAATACCAAAAAAAGCAAGG + Intergenic
1099283954 12:80691750-80691772 TATAAATACTTCAACAAACTTGG + Intergenic
1101316087 12:103630209-103630231 GATAAAGGCCTCAACAAGAATGG + Intronic
1101588842 12:106108755-106108777 CATAAATTCTTCACCATGCAGGG + Intronic
1103551740 12:121742971-121742993 AATAAATACCACCACAGGCAGGG - Intronic
1106487100 13:30181578-30181600 CATAGAAACCTGAACAAGGACGG + Intergenic
1108014006 13:46054076-46054098 CATTTATACTTCCACAAGCAGGG + Intronic
1108374662 13:49802899-49802921 CATAAATTCCTCAAATAGTAGGG - Intergenic
1109551806 13:63913505-63913527 TATATATACCACAACAAGCCTGG + Intergenic
1111020535 13:82442945-82442967 AATAAAAACCTCAACAAACTAGG - Intergenic
1111079994 13:83292770-83292792 GATAAATATGCCAACAAGCATGG + Intergenic
1111686890 13:91513245-91513267 CATAAAAATCTCACCAAGCAGGG - Intronic
1112700624 13:102003727-102003749 AAGAAATACCTGAAGAAGCAAGG + Intronic
1113166164 13:107445522-107445544 CACAAATACCTGTACACGCATGG - Intronic
1114220331 14:20690456-20690478 TCTAAATTCCTCAAAAAGCAAGG - Intronic
1115354878 14:32436644-32436666 TTTAAATACGTAAACAAGCATGG + Intronic
1119040821 14:71272788-71272810 CATAAATAACACAATAAACATGG + Intergenic
1120199958 14:81526694-81526716 CCTAAATAAATCAAAAAGCAAGG + Intronic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1126783975 15:52161735-52161757 CCTGAATGACTCAACAAGCAAGG + Intronic
1130620815 15:85460469-85460491 CATAAATGGCTCAATAAACATGG - Intronic
1135531504 16:23258692-23258714 CCTAAATACCTCTATAATCATGG - Intergenic
1138627052 16:58260807-58260829 CAGAAAGACCTCACCAAGCTGGG + Intronic
1138860887 16:60755197-60755219 CATCAATACCTCCACCACCATGG - Intergenic
1139457206 16:67090440-67090462 CATATATACCCCAAAAAGAAAGG - Intronic
1140587672 16:76312815-76312837 CATTAATATATCAACAAGGAGGG + Intronic
1144379023 17:14674378-14674400 CATAAAGACCTCAAGACTCAGGG + Intergenic
1146401232 17:32501576-32501598 CATAAAAAACTCAAGAAGGATGG + Intronic
1146461890 17:33052640-33052662 CCCAAAGACCCCAACAAGCAGGG - Intronic
1147928079 17:43957674-43957696 CATAAATAAATAAATAAGCATGG + Intronic
1149008424 17:51829901-51829923 CATAAATAGCTCAAAAGGCCGGG + Intronic
1150811853 17:68363107-68363129 TATTAATACCGCAAGAAGCAGGG + Intronic
1151876818 17:76871642-76871664 CATAAAGACACAAACAAGCATGG + Intronic
1153208014 18:2724546-2724568 AATAAATACCTAAAGAAGCCAGG - Intronic
1155167658 18:23244578-23244600 CTTAATTACCTTAACAAGCACGG + Intronic
1158406262 18:57162319-57162341 CAGAAATTCCTCAATAAACAAGG - Intergenic
1160095110 18:75864142-75864164 AACAAAGACCTCAAAAAGCAAGG + Intergenic
1163473336 19:17510837-17510859 CTTAAAAAATTCAACAAGCATGG + Intergenic
1165589890 19:36959197-36959219 AATAAAAACTTCAACAAGCTAGG - Intronic
929689448 2:44062241-44062263 CATAAAAACATTAACATGCATGG - Intergenic
934905831 2:98201921-98201943 CAAAAAAACCTCAACAAGATAGG - Intronic
935058380 2:99587437-99587459 CATTAGCTCCTCAACAAGCAAGG + Intronic
935972550 2:108544363-108544385 CATACATCCCTCAAGAAGTATGG - Intronic
937625102 2:124035029-124035051 CATAAATATCTGAAGAAGGAAGG - Intronic
941595680 2:167474021-167474043 CATAAATACATGAAATAGCATGG + Intergenic
944986390 2:205182340-205182362 GATACTTACCTCAACAAACAAGG + Intronic
1175362707 20:58426194-58426216 CATAAATAACTAAACAAACAAGG - Intronic
1177718595 21:24874099-24874121 GATAAAAACCTCAACAAACTAGG - Intergenic
1179244218 21:39616534-39616556 CATAAATACCACAGAAAGGAAGG - Intronic
1181561223 22:23702411-23702433 CATATATACCACAAAAAGCTAGG + Intergenic
1184985441 22:48130303-48130325 CATTAAAACCTCACCAAGGAGGG + Intergenic
955506259 3:59636174-59636196 CATACAGACCTCAACCAGAAAGG + Intergenic
955658213 3:61267441-61267463 CATAAATACCACTGCAGGCAGGG + Intergenic
958502361 3:94928695-94928717 CAAAATTTCCTAAACAAGCATGG - Intergenic
959338954 3:105103282-105103304 CATTTATAAGTCAACAAGCATGG + Intergenic
960043586 3:113174932-113174954 CAGAAATTCTTCAACATGCAAGG - Intergenic
960850524 3:122048138-122048160 CATAAAACCCTCAACAAACTAGG - Intergenic
961857824 3:129890784-129890806 CATAAATTGCTCAAAAAGTATGG - Intronic
965157879 3:165087955-165087977 CATATATACATAAATAAGCACGG - Intergenic
965601620 3:170460399-170460421 CATAAATACCTCAACTGTCTGGG - Exonic
965718714 3:171636940-171636962 CAAAAAAACCTCAACAAACTTGG - Intronic
966157065 3:176928075-176928097 CATAAATAGCTCATGAAGGATGG + Intergenic
967142389 3:186571564-186571586 AATAAATAGCTCAAGAAGCTGGG - Intronic
967435128 3:189435577-189435599 GATAAAAACCTCAACAACCTAGG + Intergenic
967550759 3:190792726-190792748 CATAAATACCTCAAAACAAATGG - Intergenic
968563674 4:1298078-1298100 CTAAAATGCCTCAAGAAGCATGG - Intronic
970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG + Intergenic
971895205 4:32584240-32584262 CAAAAATACCTCTAGAAGCCCGG + Intergenic
972147984 4:36052987-36053009 CCTAAATACTTCAGCATGCAGGG + Intronic
974014349 4:56635237-56635259 CATAAATCCCTTAAAAAGAAGGG - Intergenic
975257780 4:72258127-72258149 TATCAATACCTCAACAACCTGGG + Intergenic
976784710 4:88805002-88805024 AATAAATACCTCAAATAGAAAGG + Exonic
977889817 4:102296814-102296836 CATAAGTAACTCAACAGGGAGGG + Intronic
979290388 4:118973613-118973635 AGTAAATAACTCAACACGCATGG - Intronic
980372353 4:131892559-131892581 AATAATTACTTCAACAAGAAGGG + Intergenic
981017022 4:139984401-139984423 CATACATATTTTAACAAGCATGG + Intronic
981361687 4:143853030-143853052 GATAAAAACCTCAACAAACTAGG - Intergenic
984595592 4:181663836-181663858 CATTGATAACTCAAAAAGCATGG - Intergenic
985394118 4:189524022-189524044 CATAAAACACTCAACAAGCTAGG - Intergenic
986075187 5:4329054-4329076 AAAAAAAACCTCAATAAGCATGG - Intergenic
986490406 5:8283442-8283464 TATAAATACCTGAAAAACCAAGG + Intergenic
992010335 5:72519264-72519286 CATAAATAACTCTAAAATCAGGG - Intergenic
992225251 5:74614132-74614154 AATAAATGCCTCATCTAGCATGG - Intergenic
994531301 5:100975661-100975683 CATAAAAACCTCAAAAACCGGGG + Intergenic
998195146 5:140062564-140062586 AATAAATACCTCCAGAAACAGGG + Intergenic
1000049712 5:157551856-157551878 AATCAATACCACAACAAGCTGGG + Intronic
1000280847 5:159780643-159780665 CATAATTTCCTCCAGAAGCATGG + Intergenic
1001895781 5:175379020-175379042 CATAAATACCTTAAAAAGGGGGG + Intergenic
1001932201 5:175681174-175681196 CATAAATAGCCCAAACAGCATGG - Intronic
1003220019 6:4152889-4152911 CATGAAAACCTCAACATGTATGG - Intergenic
1003450430 6:6226263-6226285 CATGAATGCCTCAAGTAGCAAGG - Intronic
1004280334 6:14275034-14275056 AAAACAAACCTCAACAAGCAAGG - Intergenic
1004728057 6:18330195-18330217 CATAATTTCCTTAAAAAGCAAGG + Intergenic
1008975195 6:57418095-57418117 AAAAAATGCCTCAACAAACAAGG + Intronic
1010130698 6:72490047-72490069 CCTAAATACCTCAAATACCAAGG - Intergenic
1010618957 6:78050024-78050046 CATAAATTTCTCTACAAGGATGG + Intergenic
1010629244 6:78177395-78177417 CATAAAACCCTCAACAAACTAGG + Intergenic
1013857193 6:114587713-114587735 CATAGATATCTAAACAACCAAGG - Intergenic
1017381350 6:153834862-153834884 TATAGATACCTAAAAAAGCAGGG - Intergenic
1017502713 6:155040243-155040265 GATAAATACTTCATCAATCAGGG + Intronic
1018257847 6:161940214-161940236 CCTCAATACTTCAGCAAGCATGG - Intronic
1021705808 7:23366514-23366536 GAATAATACTTCAACAAGCATGG + Intronic
1022685777 7:32594930-32594952 CATAAATAGGTCAACAGGCCTGG + Intergenic
1024029810 7:45449796-45449818 CAAAAAAACTTCAACAAACATGG + Intergenic
1024500201 7:50097112-50097134 CATAAATAGCTCCACAGCCATGG + Intronic
1025886120 7:65594609-65594631 AATTAATACCTCAAAAAGGATGG - Intergenic
1026145912 7:67746645-67746667 CATAATCTCCACAACAAGCATGG + Intergenic
1032861184 7:135881068-135881090 AAAAAAAACCTCAACAGGCAAGG - Intergenic
1032882764 7:136107151-136107173 GATAAAAACCTCAACAAACTAGG - Intergenic
1034113293 7:148559254-148559276 TATAAATACCACAACAAATATGG - Intergenic
1035482476 7:159198342-159198364 CTTAAGTCCCTCACCAAGCAGGG - Intergenic
1038413768 8:27378176-27378198 CATATCTCCCTCAACAACCAAGG + Intronic
1044369219 8:91389425-91389447 CATAAATACCTCAACAAGCATGG - Exonic
1047452915 8:124982466-124982488 CATCATTACCTCAAGAAGAAAGG + Intergenic
1047998955 8:130360939-130360961 CTTAATTAGCTCAACTAGCATGG - Intronic
1051417530 9:16858184-16858206 TATAAATACCTCAAAAGGAAAGG - Intronic
1053111199 9:35461258-35461280 CATGAATAACACCACAAGCAGGG + Intergenic
1053512102 9:38696480-38696502 CATAAACACATGAGCAAGCAGGG + Intergenic
1053637087 9:40020409-40020431 AATAATTACTTCAACAAGAAGGG + Intergenic
1053768944 9:41444515-41444537 AATAATTACTTCAACAAGAAGGG - Intergenic
1054317917 9:63617253-63617275 AATAATTACTTCAACAAGAAGGG + Intergenic
1054547612 9:66355989-66356011 AATAATTACTTCAACAAGAAGGG - Intergenic
1055815181 9:80196533-80196555 CATAAGTCCCTCACCAGGCAAGG - Intergenic
1055967480 9:81879810-81879832 CATAAATGCCACAGCAAGCTTGG - Intergenic
1057187430 9:93064785-93064807 TACAAATACCACAACAGGCAGGG - Intronic
1058206026 9:102109092-102109114 TCTAAAAACCTCAACAAACAAGG - Intergenic
1058650448 9:107170964-107170986 CAGAAAAACCACAACAATCAGGG - Intergenic
1185627693 X:1494023-1494045 CAGAAATACCCCAGCTAGCAGGG - Intronic
1192713295 X:73614932-73614954 CAAAAAAACATCAAAAAGCAAGG - Intronic
1194085460 X:89521706-89521728 CTTAAAATCCTCAACAAGCAAGG - Intergenic
1195713460 X:107794780-107794802 AAAAAATACATCAACAAGTAAGG - Intergenic
1200365576 X:155658866-155658888 GATAAAACCCTCAACAAGCTAGG - Intronic
1200438103 Y:3177575-3177597 CTTAAAATCCTCAACAAGCAAGG - Intergenic
1201456906 Y:14178096-14178118 CATATATACCTCAATATCCAAGG - Intergenic