ID: 1044369783

View in Genome Browser
Species Human (GRCh38)
Location 8:91395849-91395871
Sequence GTTTTCCACTGAAGCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 3, 3: 8, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044369778_1044369783 21 Left 1044369778 8:91395805-91395827 CCCAATAGCTCTAATTTTAACAT 0: 1
1: 0
2: 3
3: 31
4: 392
Right 1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG 0: 1
1: 1
2: 3
3: 8
4: 176
1044369781_1044369783 -7 Left 1044369781 8:91395833-91395855 CCCAATAAGAGGCTCTGTTTTCC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG 0: 1
1: 1
2: 3
3: 8
4: 176
1044369782_1044369783 -8 Left 1044369782 8:91395834-91395856 CCAATAAGAGGCTCTGTTTTCCA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG 0: 1
1: 1
2: 3
3: 8
4: 176
1044369779_1044369783 20 Left 1044369779 8:91395806-91395828 CCAATAGCTCTAATTTTAACATT 0: 1
1: 1
2: 4
3: 27
4: 387
Right 1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG 0: 1
1: 1
2: 3
3: 8
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044369783 Original CRISPR GTTTTCCACTGAAGCTTTGT TGG Intronic
900154026 1:1196942-1196964 TTTGTCCACTGAAGCTCTGAGGG - Intronic
900895669 1:5481368-5481390 GGTTTCCACTTAAACTATGTTGG - Intergenic
904223951 1:28999028-28999050 GTTTTTCACTGTAGTTTTGAGGG - Intronic
906600092 1:47118648-47118670 GTTTTCCACTGCAGATATATGGG - Intergenic
908238016 1:62166084-62166106 GTTTTCCAATAAACCTTAGTGGG + Intergenic
908993238 1:70119999-70120021 TTATTCCACTGTAGCTTTGAGGG - Intronic
909506292 1:76394013-76394035 ATTGTCCACTGATGCTCTGTGGG + Intronic
910203043 1:84719598-84719620 TTTTTCCACTCATGCATTGTTGG - Intergenic
910469262 1:87533992-87534014 ATTTTCCACTGAACATTTGGTGG + Intergenic
911818189 1:102381979-102382001 GGCTACCACTGAAGCTATGTAGG + Intergenic
915457859 1:156052756-156052778 GTTTTCAAATTCAGCTTTGTAGG + Intronic
917381713 1:174417923-174417945 GTTTTCCACTGAACATTACTTGG + Intronic
919583880 1:199411138-199411160 GTTTGGAACTCAAGCTTTGTGGG - Intergenic
921744813 1:218727997-218728019 GTTTTCTAATGTAGCTTTGGTGG + Intergenic
921893309 1:220373940-220373962 GTTTTCAACACAAGCTTTTTGGG + Intergenic
922660177 1:227423208-227423230 GTTTTCCATTTAATCTTTTTGGG + Intergenic
1074945905 10:118280356-118280378 GTTTCCCACTGCAGCTCTGATGG + Intergenic
1078419065 11:11192975-11192997 GTTGTCAACTTAAGCTTTGGGGG - Intergenic
1081186926 11:40054706-40054728 CCATTCCACTGAAGTTTTGTGGG - Intergenic
1082983295 11:59143876-59143898 GTTTTCCATTGAAGAGTGGTTGG - Exonic
1084838358 11:71823435-71823457 TGGTTTCACTGAAGCTTTGTAGG - Intergenic
1085858967 11:80210093-80210115 TTTTACCACTGCAGCTGTGTAGG - Intergenic
1086996254 11:93359799-93359821 TTTTTCCACTAAGCCTTTGTAGG - Intronic
1087715011 11:101597558-101597580 GTTTTCTACTGATGATTTGGTGG + Intronic
1088670787 11:112138285-112138307 TATTTCAACTGAAGCTTTGCAGG + Intronic
1091060431 11:132456143-132456165 GGTTTCCTCTGAACCTCTGTAGG - Intronic
1093054448 12:14541599-14541621 GTTTTTAACTGAAGCTCTATAGG + Intronic
1093056969 12:14565718-14565740 GTTTTCCCTTGAGGCTTTTTGGG - Intronic
1097442462 12:59627553-59627575 GTCTTCCTCTGAAGCTTTGTGGG - Intronic
1098527698 12:71505182-71505204 TTTTTCTACTGAAGCCTTGAGGG - Intronic
1098833330 12:75390469-75390491 GTTTTTAAATGAACCTTTGTGGG - Intronic
1099817655 12:87669299-87669321 GTGTTCCACTCCAGGTTTGTTGG + Intergenic
1100430762 12:94530116-94530138 GCTTTCCCCTGTAGCTTTGGGGG + Intergenic
1101209653 12:102523304-102523326 CTTTTCCACTGAATATATGTGGG + Intergenic
1102742426 12:115219923-115219945 GTTTTCCACTAATACGTTGTGGG - Intergenic
1103984542 12:124758566-124758588 GTTTTCCACTGATGCGTTGAAGG - Intergenic
1107292443 13:38870892-38870914 GATTTCCAATTAAGCTTTATAGG - Intronic
1107830598 13:44371586-44371608 GATATTCACTGAAGCATTGTTGG + Intergenic
1110089453 13:71426533-71426555 GTTTTCTACTGTAGCTCTGATGG + Intergenic
1110663967 13:78094362-78094384 GTATTCAAATGAAGCTTTGGTGG - Intergenic
1112473398 13:99709603-99709625 CTTTTCAACTGCAGCTTTTTAGG - Intronic
1117572222 14:57058718-57058740 GATGTCCACTGCAGATTTGTGGG - Intergenic
1118264028 14:64277195-64277217 CTTTTCCATTGATACTTTGTTGG - Intronic
1118630199 14:67695540-67695562 GTTTTCCAAGAAAGCTTTGGTGG + Intronic
1118640860 14:67790961-67790983 ATTTTCTACTGAGGCTTTGGTGG - Intronic
1120193355 14:81459468-81459490 TTTATCCACTGAAGATTTGTTGG + Intergenic
1123815628 15:23975904-23975926 GTCTCCCACTGAAGCCTTTTTGG + Intergenic
1124039361 15:26086000-26086022 GCTTTCCACAGAACATTTGTAGG - Intergenic
1125035369 15:35117519-35117541 TTTTTCCCCTGAAACTTTGATGG - Intergenic
1129055724 15:72818701-72818723 GTCACCCACTGAGGCTTTGTCGG + Intergenic
1130006707 15:80106698-80106720 GTTTTCCTCTGAATTTGTGTAGG + Intronic
1130938685 15:88490429-88490451 TTTTTCCATAGCAGCTTTGTGGG + Intergenic
1132198675 15:99932874-99932896 GTGTTTCACTGAAGCTCTGCTGG + Intergenic
1135005769 16:18820764-18820786 GTTTTTTAATGAAGCTTTTTTGG - Intronic
1140945078 16:79760504-79760526 TTGTTCCACTCAAGCTTTCTGGG + Intergenic
1143964039 17:10743546-10743568 GTTTGCCAATAAAGGTTTGTAGG + Intergenic
1144142211 17:12360649-12360671 CTTTTCCACTGAAGCCTTTGTGG - Intergenic
1144353364 17:14420916-14420938 TTTTTCCCTTGAAGCTCTGTTGG - Intergenic
1146971282 17:37074433-37074455 ATTTACCAGTGAAGCTTTCTGGG + Intergenic
1147506003 17:41018342-41018364 GTTTTCCAGGGAAGCTTTAAAGG + Intronic
1148264312 17:46213021-46213043 GTTTTCCACAGAAAGTTTGTCGG - Intronic
1149737000 17:59004816-59004838 GTGTACCACTGAAGCCATGTGGG - Intronic
1150849417 17:68690349-68690371 AGTTCCCACTGAAGCTATGTTGG - Intergenic
1151691452 17:75688579-75688601 GTTTGACACTGGAGCTTTGTGGG + Intronic
1152402780 17:80078395-80078417 GTTTTCCACTAAAGTTTTCCAGG + Intronic
1153429185 18:4996860-4996882 ATTTACCAGTGAAGCTATGTGGG - Intergenic
1155838500 18:30617745-30617767 TTTTTTCACTTAAGCTTTGAAGG - Intergenic
1157335467 18:46734224-46734246 GTTATCCTCTGGAGCTTCGTAGG - Intronic
1158466218 18:57692374-57692396 GTTTTCCAGTTCAGCCTTGTTGG - Intronic
1158708201 18:59813163-59813185 GTTTTCCAGTGAGCCTTTATTGG - Intergenic
1159993896 18:74942745-74942767 GGTCCCCACTGAGGCTTTGTGGG - Intronic
1161188867 19:2941946-2941968 GTTTTCCACAGCAGCCTTCTCGG + Intronic
1163430227 19:17262909-17262931 GGCTTCCACTGCAGGTTTGTGGG + Exonic
1163918052 19:20260205-20260227 CTTTTCCATTGAAGGATTGTAGG - Intergenic
1164070256 19:21761459-21761481 GTTTTCCCATGGAGCTTTATTGG - Intronic
1164487291 19:28669646-28669668 CTGTTCCAATGAACCTTTGTAGG + Intergenic
1165506947 19:36239055-36239077 TTTTTCCACGGACGGTTTGTGGG - Intronic
1166851366 19:45763071-45763093 GTTTTCCACTGTGGCTTGGGGGG - Intronic
1167711839 19:51116501-51116523 GTTTTTAAATGAAGGTTTGTGGG - Intergenic
925630514 2:5888105-5888127 GTTTTCCTCTGAAGTTTTTATGG - Intergenic
927368979 2:22332680-22332702 GTTACCCACTGGAGGTTTGTGGG - Intergenic
928239009 2:29570383-29570405 GTTTTCCAAGGAAGCTTGGCAGG + Intronic
930706690 2:54511476-54511498 TTTTTCCACTGACGGGTTGTGGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
937415414 2:121710696-121710718 CTTTTCCAGTGAGGATTTGTGGG + Intergenic
937558477 2:123190293-123190315 GTTATCCTCTCAAGCTTTCTTGG - Intergenic
938756446 2:134384075-134384097 GTGTCCCACTGAAACTTTATGGG - Intronic
939132132 2:138248604-138248626 TTTGTCCTCTGAAGCTTTGAAGG + Intergenic
939148787 2:138448432-138448454 GTTTTTCCCTGCTGCTTTGTAGG + Intergenic
940742265 2:157522293-157522315 GTTTTTCACTGTAGCTTTTCTGG - Intergenic
941505773 2:166342891-166342913 GTTCTCCAGGGAAGCTTTGGTGG - Intronic
941904295 2:170706128-170706150 GTTTTTCATTAAATCTTTGTTGG + Intergenic
944334255 2:198511027-198511049 ATTTACCAGTGAAGCTATGTAGG - Intronic
947078602 2:226370570-226370592 TTTATCCACTAAAACTTTGTTGG + Intergenic
947296384 2:228635395-228635417 CTTTGCCACTGTGGCTTTGTGGG + Intergenic
948885670 2:240882453-240882475 ATTGTCCAGTGAAGCTTTATGGG + Intergenic
1170447553 20:16444442-16444464 GTATTCCAATAAAGCTTTATGGG - Intronic
1170985981 20:21259162-21259184 GTTTTTCTCTGAATTTTTGTGGG + Intergenic
1172784687 20:37459548-37459570 GTTTTCCTGTGAATCTTTTTGGG + Intergenic
1173784661 20:45784000-45784022 CTTTTCCACTGGAGCTTGGCAGG - Intronic
1174888772 20:54366522-54366544 GTTTTCAACTTTAGCTTTATTGG - Intergenic
1178762836 21:35420677-35420699 GTTGTGGAATGAAGCTTTGTGGG - Intronic
1180863086 22:19098484-19098506 GTTTTTCGCTAAAGCTTTATTGG - Intronic
1180987515 22:19913593-19913615 CTTTTCCTTTGAAGCTTTTTGGG - Intronic
1181487506 22:23241064-23241086 GTTTTCCACTCATGCATTGATGG + Intronic
949713373 3:6898255-6898277 GTTCTACCCTGAAGCTTTCTGGG - Intronic
951347540 3:21564013-21564035 GTTCTCCACTGAAGTCTTTTGGG + Intronic
951737567 3:25884688-25884710 GCTTTCCACTGAAGAGTTGATGG - Intergenic
953093563 3:39753249-39753271 GTTTTCCACTTAAGAGATGTTGG + Intergenic
955666518 3:61355131-61355153 GCTTCCCACTCAAGCTTTGCTGG + Intergenic
960915605 3:122691328-122691350 CTTGTCCACTGAAGCATGGTGGG - Intronic
961517954 3:127450242-127450264 GTTTTCCACTGCAGCTCCTTGGG - Intergenic
962347825 3:134633144-134633166 ATTTACCACTGAAGCTATCTGGG - Intronic
962421536 3:135233451-135233473 GTCTGCCTCTGAAGCTTTGCAGG + Intronic
966360597 3:179125293-179125315 ATTTTCCACTTAAAATTTGTAGG + Intergenic
967337087 3:188356625-188356647 GTTGCCCACTGAATCCTTGTGGG - Intronic
967570620 3:191024093-191024115 GTTTTCCATCCAAGCTTTGAGGG + Intergenic
967863528 3:194171730-194171752 TTTTTGAGCTGAAGCTTTGTTGG + Intergenic
968708400 4:2094862-2094884 TTCTTCCACTGAAGCTTGTTTGG + Intronic
970279671 4:14440667-14440689 TTTTTCCAATGCAGCTTTGGTGG - Intergenic
975426450 4:74233993-74234015 GTTCTTTACTGAAGCTTTTTTGG - Intronic
976722112 4:88178862-88178884 GTATTCCACTGAGGCTGTGCTGG - Intronic
976978861 4:91199023-91199045 TTTTTCAACTTAAACTTTGTAGG - Intronic
979871108 4:125823143-125823165 GTCTTGCATTTAAGCTTTGTTGG - Intergenic
980896641 4:138866595-138866617 GTTTTCCACTGGAGGGTGGTTGG - Intergenic
982537562 4:156625764-156625786 CTTTTCACCTGAAGCCTTGTGGG - Intergenic
983880986 4:172932396-172932418 CTTTTACAGTGAATCTTTGTGGG + Intronic
986279168 5:6309298-6309320 GTTTTACAGAGAAGCTTTCTAGG - Intergenic
986385099 5:7225661-7225683 TTTATCCATTGAGGCTTTGTGGG - Intergenic
987639013 5:20587239-20587261 ATTTTCCACTGTAGCTTTGTAGG - Intergenic
991206682 5:64058002-64058024 TTTTTAAACTGAGGCTTTGTTGG + Intergenic
991488034 5:67158160-67158182 GTCTACCACTGAAGGTTTTTTGG - Intronic
992805095 5:80329793-80329815 GTTTTCAAGGGAAGCATTGTAGG + Intergenic
993077999 5:83259443-83259465 GTTTTCCAATGGCCCTTTGTAGG + Intronic
994687620 5:102975291-102975313 GTTTTCAAATTCAGCTTTGTAGG + Intronic
995322028 5:110845757-110845779 TTTCTCCACTAAAGCTGTGTTGG + Intergenic
996505974 5:124267955-124267977 GCATTCCACTGATGTTTTGTAGG - Intergenic
996770194 5:127077613-127077635 GATTTCCCCAGAAGGTTTGTTGG + Intergenic
999534343 5:152500985-152501007 GCTTTCCACTGATGCTCTGACGG - Intergenic
1000498633 5:162019765-162019787 GTTTTCCCCTGTAGATGTGTAGG + Intergenic
1000846267 5:166284680-166284702 TTTTTCCACTGAGGCTGTATTGG - Intergenic
1005062956 6:21794226-21794248 ATTGTCCACTGATGCTCTGTGGG + Intergenic
1006643066 6:35498229-35498251 GTTTTCCGCGGGAGCTTTGCTGG + Exonic
1008843017 6:55927489-55927511 ATTTTCCTCTGAAGCTGGGTTGG - Intergenic
1013417217 6:109935818-109935840 GTATGCCACTGAAGTTTTGTGGG - Intergenic
1015306835 6:131718172-131718194 GTTTTCCAGTGAAGATGTCTAGG - Intronic
1017073670 6:150599459-150599481 GTTTTACATAGAAGCTTTGCCGG - Intergenic
1021278820 7:18690941-18690963 GTTTTCCACTAAGGGATTGTAGG + Intronic
1025024368 7:55504401-55504423 GTTTTCTGCTGAAACTTTATAGG - Intronic
1028117046 7:87010123-87010145 GTTGTAGACTGAAGCTTTGTAGG - Intronic
1028477832 7:91270302-91270324 GTTTTCCACTTAAGCTTTGTGGG + Exonic
1031919925 7:127593037-127593059 GTTTTCTCCTCAAGCTTTGCAGG + Intronic
1032806228 7:135357397-135357419 CTTTTCCAATGAAGCTCTTTTGG - Intergenic
1033909981 7:146251012-146251034 TTTTTCCAATGAAACTTTCTTGG + Intronic
1034128683 7:148697238-148697260 GTTTTCCAGTGTACCTATGTGGG - Intergenic
1034327825 7:150253365-150253387 GATGTCCACTGAAGCTGTTTGGG + Intronic
1034612865 7:152388048-152388070 GTTATGCAGTGAAGCTTTCTAGG + Intronic
1034765383 7:153716068-153716090 GATGTCCACTGAAGCTGTTTGGG - Intergenic
1036073340 8:5467069-5467091 GTTGTCCACAGAAGCTTCTTAGG - Intergenic
1036277203 8:7364904-7364926 TGGTTTCACTGAAGCTTTGTAGG - Intronic
1036344126 8:7945440-7945462 TGGTTACACTGAAGCTTTGTCGG + Intronic
1036839468 8:12106209-12106231 TGGTTACACTGAAGCTTTGTCGG + Intronic
1036861257 8:12352451-12352473 TGGTTACACTGAAGCTTTGTCGG + Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1041204459 8:55484218-55484240 ATTTTCCAGTAAAGCTTTCTTGG - Intronic
1043135196 8:76514328-76514350 GTTTCACACTGAAGCCTTTTTGG - Intergenic
1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG + Intronic
1044539690 8:93394889-93394911 GTTGTCCACTGATGCTGTCTGGG - Intergenic
1044821057 8:96156059-96156081 GTTTGCCACTGATTGTTTGTTGG - Intronic
1047260547 8:123255062-123255084 GTTATCCAATGCAGCATTGTAGG + Exonic
1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG + Intergenic
1051182462 9:14425632-14425654 GCTATCCACTGAAGCTTAGATGG + Intergenic
1055055502 9:72020259-72020281 GTTTTCCTCTGAGGGTGTGTAGG + Intergenic
1055873930 9:80919823-80919845 GTTGTCCTTTGAAGCTTTGAAGG + Intergenic
1056422095 9:86438603-86438625 ATTCTCCACTGAAGCTGTTTTGG + Intergenic
1056922609 9:90804805-90804827 GTTTTCTACTGAGGGATTGTGGG + Intronic
1058776444 9:108288785-108288807 GTTTTCCACTAAACTTTTCTTGG - Intergenic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1059587729 9:115624053-115624075 GTGATCCACTGAAGTTCTGTGGG - Intergenic
1188459172 X:30403544-30403566 GTTTACCAATGAAGGATTGTGGG - Intergenic
1188512619 X:30952987-30953009 GATTTCTTCAGAAGCTTTGTAGG - Intronic
1194078055 X:89421452-89421474 CTTTTCCACTGAATGTTTATTGG - Intergenic
1196037212 X:111158699-111158721 TTTGTCCTCTGAAGGTTTGTGGG - Intronic
1196575368 X:117311830-117311852 GTTTGCAACTCAAGCTTTTTAGG - Intergenic
1196971730 X:121116889-121116911 CATTTCCACTGAGGCATTGTAGG + Intergenic
1198124764 X:133631938-133631960 GTGTTCCACAGAACTTTTGTTGG - Intronic
1198623332 X:138538798-138538820 ATATTACACTTAAGCTTTGTAGG + Intergenic
1200430701 Y:3077002-3077024 CTTTTCCACTGAATGTTTATTGG - Intergenic
1201516184 Y:14820546-14820568 GTTTTCACCTGAAGCTTTGTTGG - Intronic