ID: 1044371594

View in Genome Browser
Species Human (GRCh38)
Location 8:91418665-91418687
Sequence GGACCTCCCTGGTGTAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044371594_1044371596 -10 Left 1044371594 8:91418665-91418687 CCTAGGTTACACCAGGGAGGTCC No data
Right 1044371596 8:91418678-91418700 AGGGAGGTCCATTGCTACACTGG No data
1044371594_1044371599 7 Left 1044371594 8:91418665-91418687 CCTAGGTTACACCAGGGAGGTCC No data
Right 1044371599 8:91418695-91418717 CACTGGGACTGCTCCACTTCTGG No data
1044371594_1044371597 -9 Left 1044371594 8:91418665-91418687 CCTAGGTTACACCAGGGAGGTCC No data
Right 1044371597 8:91418679-91418701 GGGAGGTCCATTGCTACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044371594 Original CRISPR GGACCTCCCTGGTGTAACCT AGG (reversed) Intergenic
No off target data available for this crispr