ID: 1044372364

View in Genome Browser
Species Human (GRCh38)
Location 8:91427173-91427195
Sequence TTGTAGGCATTCAATAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044372362_1044372364 6 Left 1044372362 8:91427144-91427166 CCTCAGAGGTGCTTATTGAGATT No data
Right 1044372364 8:91427173-91427195 TTGTAGGCATTCAATAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044372364 Original CRISPR TTGTAGGCATTCAATAATTA TGG Intergenic
No off target data available for this crispr