ID: 1044373750

View in Genome Browser
Species Human (GRCh38)
Location 8:91445438-91445460
Sequence CCATGGCCATGAGCCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044373750_1044373761 20 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373761 8:91445481-91445503 AGGCAAAGGTAGGTGTTCCTGGG No data
1044373750_1044373762 24 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373762 8:91445485-91445507 AAAGGTAGGTGTTCCTGGGCAGG No data
1044373750_1044373757 0 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373757 8:91445461-91445483 GGTAGAAAGAAGAAGGCTGAAGG No data
1044373750_1044373755 -7 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373755 8:91445454-91445476 GCCATGGGGTAGAAAGAAGAAGG No data
1044373750_1044373758 6 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373758 8:91445467-91445489 AAGAAGAAGGCTGAAGGCAAAGG No data
1044373750_1044373759 10 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373759 8:91445471-91445493 AGAAGGCTGAAGGCAAAGGTAGG No data
1044373750_1044373760 19 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373760 8:91445480-91445502 AAGGCAAAGGTAGGTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044373750 Original CRISPR CCATGGCCATGAGCCTTAGG AGG (reversed) Intergenic
No off target data available for this crispr