ID: 1044373759

View in Genome Browser
Species Human (GRCh38)
Location 8:91445471-91445493
Sequence AGAAGGCTGAAGGCAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044373754_1044373759 7 Left 1044373754 8:91445441-91445463 CCTAAGGCTCATGGCCATGGGGT No data
Right 1044373759 8:91445471-91445493 AGAAGGCTGAAGGCAAAGGTAGG No data
1044373750_1044373759 10 Left 1044373750 8:91445438-91445460 CCTCCTAAGGCTCATGGCCATGG No data
Right 1044373759 8:91445471-91445493 AGAAGGCTGAAGGCAAAGGTAGG No data
1044373756_1044373759 -7 Left 1044373756 8:91445455-91445477 CCATGGGGTAGAAAGAAGAAGGC No data
Right 1044373759 8:91445471-91445493 AGAAGGCTGAAGGCAAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044373759 Original CRISPR AGAAGGCTGAAGGCAAAGGT AGG Intergenic
No off target data available for this crispr