ID: 1044380872

View in Genome Browser
Species Human (GRCh38)
Location 8:91531831-91531853
Sequence AGTATATACCAGCATCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044380869_1044380872 -4 Left 1044380869 8:91531812-91531834 CCTTTGAATTCTATCCTCCAGTA No data
Right 1044380872 8:91531831-91531853 AGTATATACCAGCATCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044380872 Original CRISPR AGTATATACCAGCATCTAGA AGG Intergenic
No off target data available for this crispr