ID: 1044382583

View in Genome Browser
Species Human (GRCh38)
Location 8:91551787-91551809
Sequence AGTGGTCCACAGTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044382583_1044382588 13 Left 1044382583 8:91551787-91551809 CCTTCCTCAAACTGTGGACCACT No data
Right 1044382588 8:91551823-91551845 ATGATTCCACTTCTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044382583 Original CRISPR AGTGGTCCACAGTTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr