ID: 1044387250

View in Genome Browser
Species Human (GRCh38)
Location 8:91603492-91603514
Sequence CTGCATCTTGCTCTGTTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044387250_1044387253 15 Left 1044387250 8:91603492-91603514 CCCGGCAACAGAGCAAGATGCAG No data
Right 1044387253 8:91603530-91603552 AATAAATAAAAATAAAGGCCAGG No data
1044387250_1044387252 10 Left 1044387250 8:91603492-91603514 CCCGGCAACAGAGCAAGATGCAG No data
Right 1044387252 8:91603525-91603547 AAGTAAATAAATAAAAATAAAGG 0: 6
1: 77
2: 259
3: 1546
4: 7026
1044387250_1044387254 20 Left 1044387250 8:91603492-91603514 CCCGGCAACAGAGCAAGATGCAG No data
Right 1044387254 8:91603535-91603557 ATAAAAATAAAGGCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044387250 Original CRISPR CTGCATCTTGCTCTGTTGCC GGG (reversed) Intergenic
No off target data available for this crispr