ID: 1044391759

View in Genome Browser
Species Human (GRCh38)
Location 8:91660669-91660691
Sequence CCTCATCTGCAGACTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044391749_1044391759 13 Left 1044391749 8:91660633-91660655 CCACCTTGCCCAAAGCCACATCC No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391753_1044391759 4 Left 1044391753 8:91660642-91660664 CCAAAGCCACATCCTTTGCAGGG No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391755_1044391759 -2 Left 1044391755 8:91660648-91660670 CCACATCCTTTGCAGGGCAGCCC No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391756_1044391759 -8 Left 1044391756 8:91660654-91660676 CCTTTGCAGGGCAGCCCTCATCT No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391751_1044391759 5 Left 1044391751 8:91660641-91660663 CCCAAAGCCACATCCTTTGCAGG No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391750_1044391759 10 Left 1044391750 8:91660636-91660658 CCTTGCCCAAAGCCACATCCTTT No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data
1044391748_1044391759 29 Left 1044391748 8:91660617-91660639 CCTCAGCTAAGGACAGCCACCTT No data
Right 1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044391759 Original CRISPR CCTCATCTGCAGACTGAGCC AGG Intergenic
No off target data available for this crispr