ID: 1044414215

View in Genome Browser
Species Human (GRCh38)
Location 8:91917713-91917735
Sequence TCCAATGCTGGATCCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044414215_1044414218 11 Left 1044414215 8:91917713-91917735 CCTGGACAGGATCCAGCATTGGA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108
1044414215_1044414222 23 Left 1044414215 8:91917713-91917735 CCTGGACAGGATCCAGCATTGGA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1044414222 8:91917759-91917781 TAAACCTATGGAAAAGCTTCTGG 0: 1
1: 1
2: 0
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044414215 Original CRISPR TCCAATGCTGGATCCTGTCC AGG (reversed) Intergenic