ID: 1044414217

View in Genome Browser
Species Human (GRCh38)
Location 8:91917725-91917747
Sequence TAGCACAGCCAATCCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044414217_1044414224 21 Left 1044414217 8:91917725-91917747 CCAGCATTGGATTGGCTGTGCTA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1044414224 8:91917769-91917791 GAAAAGCTTCTGGTTCTTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 182
1044414217_1044414222 11 Left 1044414217 8:91917725-91917747 CCAGCATTGGATTGGCTGTGCTA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1044414222 8:91917759-91917781 TAAACCTATGGAAAAGCTTCTGG 0: 1
1: 1
2: 0
3: 21
4: 170
1044414217_1044414218 -1 Left 1044414217 8:91917725-91917747 CCAGCATTGGATTGGCTGTGCTA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044414217 Original CRISPR TAGCACAGCCAATCCAATGC TGG (reversed) Intergenic