ID: 1044414218

View in Genome Browser
Species Human (GRCh38)
Location 8:91917747-91917769
Sequence ACCCACCTCTTTTAAACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044414215_1044414218 11 Left 1044414215 8:91917713-91917735 CCTGGACAGGATCCAGCATTGGA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108
1044414217_1044414218 -1 Left 1044414217 8:91917725-91917747 CCAGCATTGGATTGGCTGTGCTA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108
1044414213_1044414218 17 Left 1044414213 8:91917707-91917729 CCTCAACCTGGACAGGATCCAGC 0: 1
1: 0
2: 3
3: 10
4: 193
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108
1044414212_1044414218 18 Left 1044414212 8:91917706-91917728 CCCTCAACCTGGACAGGATCCAG 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1044414218 8:91917747-91917769 ACCCACCTCTTTTAAACCTATGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044414218 Original CRISPR ACCCACCTCTTTTAAACCTA TGG Intergenic