ID: 1044416866

View in Genome Browser
Species Human (GRCh38)
Location 8:91948972-91948994
Sequence CAGGGTGAAGAAGGGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044416866_1044416879 8 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416879 8:91949003-91949025 GTCCCGCTTTCCTGGGGCAGGGG 0: 83
1: 53
2: 239
3: 305
4: 378
1044416866_1044416878 7 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416878 8:91949002-91949024 AGTCCCGCTTTCCTGGGGCAGGG 0: 88
1: 55
2: 253
3: 300
4: 310
1044416866_1044416875 1 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416875 8:91948996-91949018 GTGGCAAGTCCCGCTTTCCTGGG 0: 32
1: 210
2: 434
3: 336
4: 260
1044416866_1044416877 6 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416877 8:91949001-91949023 AAGTCCCGCTTTCCTGGGGCAGG 0: 93
1: 52
2: 252
3: 310
4: 306
1044416866_1044416876 2 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416876 8:91948997-91949019 TGGCAAGTCCCGCTTTCCTGGGG 0: 21
1: 143
2: 390
3: 382
4: 311
1044416866_1044416874 0 Left 1044416866 8:91948972-91948994 CCCTCAACCCCTTCTTCACCCTG No data
Right 1044416874 8:91948995-91949017 AGTGGCAAGTCCCGCTTTCCTGG 0: 22
1: 131
2: 329
3: 265
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044416866 Original CRISPR CAGGGTGAAGAAGGGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr