ID: 1044422767

View in Genome Browser
Species Human (GRCh38)
Location 8:92017147-92017169
Sequence TTCTGCAAATGAAAAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 753}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044422767 Original CRISPR TTCTGCAAATGAAAAATCAA GGG (reversed) Intronic
901172649 1:7271965-7271987 TTCTGACAAAGAAAAACCAAGGG + Intronic
901435331 1:9244025-9244047 TTCTGCAAATGGAAAAGCTGAGG - Intronic
901825903 1:11860869-11860891 TTTTGCAGATGAAATATAAATGG + Intergenic
903031685 1:20468241-20468263 TTTTGCAGATTCAAAATCAAAGG + Intergenic
903363383 1:22791052-22791074 TTTTGCAGATGAGAAAACAAAGG - Intronic
903912979 1:26742025-26742047 TTTTACATATGAAAAACCAAGGG + Intronic
904574294 1:31493096-31493118 TTTTACAGATGAAAAATCAGAGG - Intergenic
904757260 1:32774793-32774815 TTATGGAAATTAAAAATCAGAGG - Exonic
905507066 1:38488550-38488572 TTCTGCAAATGAGGAAACAGAGG - Intergenic
905831025 1:41067589-41067611 TTCTGGAAAAGACAAATCTATGG + Intronic
906171927 1:43733649-43733671 TTCTTAAAATGAAAAATAATGGG - Intronic
906988832 1:50715632-50715654 TTCTGCTAATGAAAGAGCATTGG - Intronic
907040662 1:51256270-51256292 TTCTGCAAATGGCAAAACTATGG - Intronic
907207812 1:52789988-52790010 TTCTGTAACTAAAGAATCAAAGG - Exonic
907319115 1:53591839-53591861 TTTTACAAATGAAGAAACAAAGG - Intronic
907556912 1:55352107-55352129 TTTTGCAGATGAAAAACCTAAGG - Intergenic
907654040 1:56324135-56324157 GTCTGCAAATAAAGAATCAGAGG - Intergenic
907887956 1:58611060-58611082 TTTTGCAAATGAAAAAACTGAGG - Intergenic
908917337 1:69144511-69144533 TTATGCAAATGAAATTTGAAGGG - Intergenic
909098069 1:71314622-71314644 TTCTGCAAAAGAAAAAAAAGGGG - Intergenic
909512467 1:76470192-76470214 TTCGGCAACAGAATAATCAAAGG + Intronic
910365509 1:86460839-86460861 ATCTGCAAATGCAAAATGCAGGG + Intergenic
910552512 1:88492104-88492126 TTCTACAAATGAATAAGAAAAGG + Intergenic
910553560 1:88504267-88504289 TAATGCAAATAAAAAATTAAAGG - Intergenic
910574874 1:88750056-88750078 TTCTACAAATGAGAAAACCAAGG - Intronic
912004927 1:104886164-104886186 TAGTGCATATGAAAAAGCAAAGG - Intergenic
912593156 1:110848131-110848153 TTCTGGAGATGGAAAATCCAAGG + Intergenic
912661447 1:111534702-111534724 TGATGTAAATGTAAAATCAAGGG + Intronic
912704620 1:111902710-111902732 TTTTGCAGATGAGAAAACAAAGG - Intronic
912807627 1:112770500-112770522 TTTTACAAATGAAAAAACAGAGG + Intergenic
913029625 1:114887142-114887164 TTTTAAAAATGAAAAATCACTGG - Intronic
913261870 1:117005781-117005803 ATCTGCAAATGCCAAATCCATGG - Intronic
913445018 1:118941900-118941922 TTTTACAAATGATAAAACAAAGG - Intronic
915833814 1:159157006-159157028 TTCTCAAAATGAAAAAAAAAAGG + Intergenic
916185662 1:162130222-162130244 TTTTGCAGATGAGAAAACAAAGG + Intronic
916800704 1:168213618-168213640 TTCTGGAAAGGCAAAATCATTGG + Intergenic
917696870 1:177534206-177534228 ATCTGCAACTGGAAATTCAAAGG - Intergenic
917715728 1:177735183-177735205 TTGAGCAAATGAAAAATGAATGG + Intergenic
917867931 1:179215431-179215453 TTATGCAACTGAAAAATGCATGG + Intronic
917966559 1:180182689-180182711 TTCTGCAATTAGAAAACCAAAGG - Intronic
918398734 1:184143049-184143071 TTCTGCAGATGAAAAAACTGAGG + Intergenic
918439689 1:184554721-184554743 TTCTGTAAATTAGAAAACAAAGG - Intronic
918621306 1:186609149-186609171 TTATTCATTTGAAAAATCAAGGG - Intergenic
918636969 1:186788088-186788110 TACTGCATATGAAAAAACACTGG + Intergenic
918640474 1:186834903-186834925 TTGTCCAAATGATAAATCCAAGG - Intronic
920507715 1:206528346-206528368 TTCTGGAAAAGATAAATCTATGG + Intronic
921326738 1:213992313-213992335 TTCTTCAAAATAAATATCAAAGG + Intronic
921451624 1:215315233-215315255 TTCCGAAAATAAAAAATCAATGG - Intergenic
922054991 1:222033458-222033480 TTTTGCAGATGAAAAATCTAAGG + Intergenic
922356535 1:224781814-224781836 TTTTGCAAATGAAGAAACAGAGG + Intergenic
922398772 1:225228997-225229019 TCCTGCACACGAAAGATCAAAGG - Intronic
922530774 1:226343292-226343314 TTCGGGAGATGAGAAATCAAAGG + Intergenic
922847224 1:228696366-228696388 TTCTGCTAATGAATAAGAAATGG - Intergenic
922855563 1:228772303-228772325 TTCTGCAAAAGAAATGGCAAGGG - Intergenic
922858867 1:228798314-228798336 TTCTTTAAAAGAGAAATCAATGG + Intergenic
923018242 1:230143259-230143281 TTCTGCGTGTGAAAAATCAGGGG + Intronic
923300756 1:232638489-232638511 TTTTGGAAATGACAAATAAATGG - Intergenic
924018331 1:239752637-239752659 ATTTGCAAATGAAAAACAAAAGG - Intronic
924257410 1:242196202-242196224 TTTTGTTAATGAAAATTCAAAGG - Intronic
924777839 1:247122916-247122938 TTCTGTAAATTAAAAAGCAATGG + Intronic
1062787123 10:273908-273930 TTATTCACAAGAAAAATCAATGG - Intergenic
1063404176 10:5776790-5776812 TTCTGGAGATGGAAAATCCAAGG - Intronic
1063680823 10:8186062-8186084 TTCAGCAAATAAATAATCATGGG - Intergenic
1064442402 10:15365458-15365480 TTCTGAAAATGGTAAATGAAAGG + Intronic
1064474607 10:15673766-15673788 TTCAGCAAAAGAGAAATCCATGG + Intronic
1064575389 10:16740319-16740341 TTCTGCAAACAAAAAATAGAAGG + Intronic
1064941812 10:20743717-20743739 TTCTGCAAAGGAAGAAGGAAGGG - Intergenic
1065308758 10:24394291-24394313 TTCTGCAAATGAAAAGTTGGTGG - Intronic
1066029461 10:31405062-31405084 TTCTGCAGATGAGAAATAACAGG + Intronic
1066781883 10:38958844-38958866 TTTTGAAAATGAAAAGACAAAGG + Intergenic
1067368507 10:45659830-45659852 GTCTGCAGATGACCAATCAAAGG - Intronic
1067658589 10:48216738-48216760 TTTTGCAGATGAAAAAGCCAAGG + Intronic
1068158182 10:53228322-53228344 TTATGCAAAAGAAAAAAAAAAGG + Intergenic
1068236403 10:54239701-54239723 TTCTGCAAATTTAAAAGAAATGG + Intronic
1068243947 10:54340764-54340786 TGCCCCAAAAGAAAAATCAAGGG - Intronic
1068634189 10:59330410-59330432 GTATTCAAATGTAAAATCAATGG + Intronic
1068991342 10:63154142-63154164 TTCTGGAGATGGAAAATCCAAGG - Exonic
1069097398 10:64276025-64276047 ATTGGCAAATGGAAAATCAAGGG - Intergenic
1069195292 10:65544044-65544066 TTTTTCAAATGACAAATAAAGGG - Intergenic
1069280987 10:66653123-66653145 TTAGGCAAAAGAAAAATAAATGG + Intronic
1069318895 10:67143086-67143108 TTTTGAAAATGAAACAACAATGG + Intronic
1069410720 10:68150641-68150663 ATTTACAAATGAAAAACCAAGGG + Intronic
1070109556 10:73471116-73471138 TTTTGGAAATGAAAAATCACAGG - Exonic
1070597075 10:77840071-77840093 TTGTGCAAATGAAGAAACTAAGG + Intronic
1071099312 10:82016625-82016647 TGATGCAAATGAAAAATTACAGG + Intronic
1071849672 10:89556224-89556246 TTCTGCAAATTATTTATCAATGG - Intronic
1071954818 10:90746128-90746150 TTCTGAAAATAACAAAACAAGGG - Intronic
1072054976 10:91745914-91745936 CTCTGCAAATGAACAAAGAAAGG + Intergenic
1072073043 10:91938970-91938992 TTCTGCAAAAAAAAAAAAAAGGG + Intronic
1072820209 10:98549217-98549239 TTTTACAGATGAAAAATCTAAGG - Intronic
1073020537 10:100439973-100439995 ATCTGCATGGGAAAAATCAAAGG + Intergenic
1073227879 10:101939198-101939220 TTGAGAAAATGAAAAATCAAAGG + Intronic
1073584678 10:104698333-104698355 TTTTGCAAATAACAACTCAATGG + Intronic
1074391883 10:113064851-113064873 TGCTTCAGCTGAAAAATCAATGG - Intronic
1074467626 10:113697538-113697560 TTCAGCAAATGAAGATTCAGTGG + Exonic
1074534085 10:114316134-114316156 TTCCTCAAATGAAAGATGAAAGG + Intronic
1074938808 10:118214800-118214822 TGCTGTAAATGAAAACACAAGGG + Intergenic
1075010856 10:118869095-118869117 TTCTACAAATGCAAAAACAAAGG + Intergenic
1075784797 10:125041808-125041830 TTATACAAATTAAAATTCAAAGG - Intronic
1076283379 10:129270457-129270479 TTGTTGAAATGAAATATCAATGG + Intergenic
1077648049 11:3943814-3943836 ATATGCAAAGGAAAAATGAAAGG - Intronic
1077786033 11:5384344-5384366 TTTTCCAAGTGAAAAATCTAAGG - Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1079000748 11:16753367-16753389 GTCTCCAAAAGAAAAATAAAAGG - Intronic
1079179353 11:18175014-18175036 CTCTGTAAATGAATAATAAATGG - Intronic
1079221010 11:18561236-18561258 TTTTACAAATGAAGAAACAAAGG - Intronic
1079288593 11:19164692-19164714 TTTTGCAATTGAGGAATCAAGGG + Intronic
1079421501 11:20294243-20294265 TTCCGCAAATGACATATAAATGG + Intergenic
1079505594 11:21148903-21148925 TTCTGCATATGGAAAACTAAGGG + Intronic
1079666202 11:23109103-23109125 TTGTTCAAATTAAAAATAAAAGG + Intergenic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1080423898 11:32138722-32138744 TTCTGAACATGAAATATCCAAGG - Intergenic
1080621665 11:33991857-33991879 TTCTGTAAAGGAAATATCATAGG + Intergenic
1080768991 11:35323027-35323049 TCCTGCAAATGAAACTTAAAGGG + Intronic
1081124292 11:39303692-39303714 TTCTTAAAATTAAAATTCAAAGG - Intergenic
1081925827 11:46827283-46827305 TTCTTCAAATGGCAACTCAAAGG + Intronic
1083224748 11:61277711-61277733 TTCTGCAGATGAAAAGACAGAGG - Intronic
1084689111 11:70714767-70714789 TTTTGCAAAAGAAAAAAAAAAGG - Intronic
1085100091 11:73793426-73793448 TGCTGCAAATGAAAGATTCAGGG + Intronic
1085831598 11:79906821-79906843 TTCTTAAAATGAAAAATTACAGG + Intergenic
1086145875 11:83551123-83551145 TTCTGTATATGAAAAATGAGGGG + Intronic
1086754154 11:90537541-90537563 TTTTGGAAATGAAAATTCATAGG - Intergenic
1086788145 11:90998408-90998430 TTTTACACATGAGAAATCAAAGG - Intergenic
1087355864 11:97093579-97093601 TTGTGTAAATGTAAAATTAAAGG + Intergenic
1087706105 11:101493635-101493657 TTTTGCACATGAAAAAACTAAGG + Intronic
1089890139 11:121872549-121872571 TTCTTCAAATGGAAAATTAGAGG + Intergenic
1089997680 11:122924375-122924397 TTTTGCAAATGAGAAAACAAAGG - Intronic
1090873034 11:130764748-130764770 TTCAGCAAATGTAGAACCAAGGG - Intergenic
1091349592 11:134882247-134882269 TTCTCCAGAGGAAAAAACAAAGG - Intergenic
1091572838 12:1704982-1705004 TGCTGCAAATGGAAAATTCAAGG - Intronic
1091576092 12:1737077-1737099 TTCTGCAACTGAAGAATTCAAGG - Intronic
1091656410 12:2349732-2349754 TTCTGCAGATGAAGAAACAGAGG - Intronic
1092861246 12:12721015-12721037 TTCTGCAAAAGAAAACAAAACGG - Exonic
1093087174 12:14879153-14879175 TTCTTCAACTGAAAAATGAGGGG + Intronic
1093431018 12:19085027-19085049 ATCTACAGATGAAAAATAAATGG - Intergenic
1093541337 12:20289379-20289401 TTCTTAAAATGAAACAACAATGG - Intergenic
1093785761 12:23190252-23190274 GTCTGCAAAAGAACCATCAATGG - Intergenic
1094028551 12:25985033-25985055 ATCTGCATCTGAAAAATGAAAGG - Intronic
1094111474 12:26867171-26867193 TTCTGCAAAAAAAAAAAAAAAGG - Intergenic
1094604963 12:31942066-31942088 TTCTCAAATTGACAAATCAAAGG + Intergenic
1094646931 12:32334551-32334573 ATATGAAAATGAAAAAGCAATGG + Exonic
1095217066 12:39561518-39561540 TTATCCAAATGAAAACTAAAAGG + Intronic
1095588805 12:43880393-43880415 TTCTGCACAGGAAAAAAAAAAGG - Intronic
1096462701 12:51831138-51831160 TTGTGCAAATGAAGAATTACAGG + Intergenic
1096953265 12:55498593-55498615 TTTTGCAAATGATACAGCAAGGG - Intergenic
1097000887 12:55875489-55875511 TTCTGCAAATGAAATCTCACAGG + Intergenic
1097789066 12:63794779-63794801 TTTTTTAAATGAAAAATCATGGG - Intronic
1098201259 12:68058299-68058321 TTCAGCAAATTAGGAATCAAAGG - Intergenic
1098301847 12:69062326-69062348 TGCTGTGAATGAAAAATAAAGGG + Intergenic
1098413909 12:70211628-70211650 GTCTTCAAAAGAAAAATAAAAGG - Intergenic
1098571522 12:71992849-71992871 TTCTTCATATGTAAAATGAAGGG + Intronic
1099594377 12:84640648-84640670 TTCAGCAAATAAAAACTTAAGGG - Intergenic
1099611079 12:84871190-84871212 AACTGCAAATGCAAAATAAAAGG + Intronic
1100238934 12:92690423-92690445 TTCTGTAACTGAAAAATGAGGGG + Intergenic
1101056579 12:100922971-100922993 CTCTGATAATGAAATATCAATGG - Intronic
1101078731 12:101159430-101159452 TTCTGCATAGTAAAAATCAGGGG + Intronic
1101254973 12:102967559-102967581 TTATGCAGATGAGAAAACAAAGG - Intergenic
1101478781 12:105076895-105076917 TTTTGCAAATGAGAAAACAAAGG + Intronic
1101621345 12:106391646-106391668 TTATGCAAATGAGAAAACAAAGG + Intronic
1101875197 12:108592821-108592843 TTTTGCAGATGAAAAAACAGAGG + Intronic
1102593834 12:113977396-113977418 TTGTGAAAATGAAAAAAGAAGGG + Intergenic
1102735803 12:115158278-115158300 TTTTGCAGATGAGAAAACAAGGG + Intergenic
1102795538 12:115686159-115686181 TTCTGCAAAGGAGAAACCAGAGG - Intergenic
1103187956 12:118977866-118977888 TTTTGCAAATGAGGAAACAAAGG + Intergenic
1104144013 12:126015383-126015405 TTCTATAAATGAAACAACAAAGG - Intergenic
1104626090 12:130356199-130356221 TTCTGAAAATGAAACATAAAAGG - Intronic
1106765598 13:32910535-32910557 TTCTGCAAAAATAAATTCAAGGG - Intergenic
1106888212 13:34213403-34213425 TTCTGCATATCAAGAATCAGTGG + Intergenic
1107131975 13:36906128-36906150 TTCTTCAAATGAAATTTGAAGGG - Intronic
1107168425 13:37311257-37311279 TTCTCCCAATGACAAATCACTGG - Intergenic
1107183424 13:37488635-37488657 TTCTGAAAATATAAAATGAAAGG - Intergenic
1107643960 13:42475378-42475400 TTATACACATGAAAAACCAAGGG + Intergenic
1108487088 13:50937771-50937793 ATCAGCAAATGAAGAATAAAAGG + Intronic
1108870537 13:54978778-54978800 TTCTTCTCATGAAATATCAAAGG + Intergenic
1108963519 13:56267219-56267241 TTCTGAAAATGAAAAGACTATGG + Intergenic
1109000737 13:56801190-56801212 ATCTGCTAATGATAACTCAAGGG - Intergenic
1109119135 13:58431560-58431582 TTTTATAAATGAAAAATCAAGGG - Intergenic
1109324338 13:60849572-60849594 TTTTGCAAATGAAAAATTTGAGG + Intergenic
1109344163 13:61095015-61095037 TTATGTAAATGAAACATCACAGG - Intergenic
1109772594 13:66996826-66996848 TACTCCAAATGCAAAATTAAAGG + Intronic
1110220696 13:73069501-73069523 AGCTGCAAATGAAAAAAAAATGG - Intronic
1110241887 13:73277029-73277051 TTCTGCAAAAAAAAAGTCATTGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110523800 13:76512282-76512304 TTCTGCAAATGAGAAAACTAAGG - Intergenic
1110721322 13:78765436-78765458 TTATACAAATGAAAAGCCAAAGG + Intergenic
1111100701 13:83581656-83581678 CTCTGCAAAAAAAAAATAAAAGG - Intergenic
1111238099 13:85435290-85435312 TTCTTCAATAGAAAAATCAATGG + Intergenic
1111342352 13:86903419-86903441 TTCTAGAGATGGAAAATCAAAGG + Intergenic
1111443955 13:88320543-88320565 TTCTGGAAATGTTAAAGCAAAGG - Intergenic
1111477171 13:88764979-88765001 TTCTAAAAATGAAAAATTACAGG - Intergenic
1111663364 13:91238234-91238256 TTCTGCACAAGAACAAGCAAAGG - Intergenic
1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG + Intergenic
1112438921 13:99411210-99411232 TTCTTCAAATGCAAATACAATGG - Intergenic
1112448863 13:99491388-99491410 TTCTCAAATTGACAAATCAAAGG + Intergenic
1112758529 13:102668057-102668079 TCCTGCACATGAATGATCAAAGG + Intronic
1113315060 13:109170530-109170552 TTCTGCAATTTAAAAAAAAAAGG + Intronic
1114898386 14:27023977-27023999 TACTGAAAATGAAATTTCAATGG + Intergenic
1115144843 14:30214694-30214716 TTCTGGAAATGAGGAAACAAAGG + Intergenic
1115320195 14:32071907-32071929 TTCTGAAAGTGAAAAAAAAATGG + Intergenic
1115330462 14:32191247-32191269 TTCTACAGAGGTAAAATCAATGG - Intergenic
1115478024 14:33834966-33834988 TTTTTCAAATGAAAACTCAATGG - Intergenic
1115637317 14:35302886-35302908 TTCTCAAAATGAAAAATGATAGG - Intronic
1116427001 14:44803263-44803285 TTAGGCAAATGAAGAATGAAGGG - Intergenic
1116442489 14:44968967-44968989 TTCTGGAAATGACAAAACTATGG - Intronic
1116607904 14:47026288-47026310 ATCTGAAAGTGAGAAATCAAAGG - Intronic
1116914682 14:50512581-50512603 TTCTCCAAATGAAGAACCGATGG + Intronic
1117199553 14:53374258-53374280 TTCTGGATCTGAAAAATAAACGG + Intergenic
1117231323 14:53722119-53722141 TTCTGCAGTTCATAAATCAAGGG + Intergenic
1117981165 14:61343185-61343207 TTTTGGAACTGATAAATCAAAGG + Intronic
1118064991 14:62180879-62180901 TTCTGCATATGTAAAATTAAGGG + Intergenic
1118558413 14:67051664-67051686 TTCTCCAAAGTAAAAATGAAGGG + Intronic
1120557519 14:85947282-85947304 TTTTGCTAAGGAAATATCAAAGG - Intergenic
1120726488 14:87947517-87947539 TTCTGAAACTGAAAAATACAGGG + Intronic
1120741938 14:88118167-88118189 TTCTGAAACTGGAAAATGAATGG - Intergenic
1120794124 14:88613095-88613117 TTCTCCCAATGGAAAAGCAATGG - Exonic
1121186389 14:91974501-91974523 TTCTGCAACTTCAAAATAAAAGG + Intronic
1121647667 14:95531066-95531088 TTCTGCAAATGTCATATTAAGGG - Intergenic
1122028263 14:98893409-98893431 TTCTTCAACTGTAAAATAAACGG - Intergenic
1122055849 14:99097827-99097849 TTCTGCAAATGAAAAGAAGAAGG + Intergenic
1122224644 14:100267116-100267138 TTCTGAAAAAGAAAAAGAAAAGG + Intronic
1202892030 14_KI270722v1_random:167967-167989 ATCTGAAAAAAAAAAATCAATGG - Intergenic
1123669005 15:22635507-22635529 TTCTTCAAAAGAAAAAGCCAAGG - Intergenic
1123885245 15:24719831-24719853 TTCTGTAACTGTAAAATAAATGG - Intergenic
1124479502 15:30065780-30065802 TGCTGCAGAAGAAAAAGCAAGGG - Intergenic
1124625557 15:31305639-31305661 GTCTGCAAATGAAACAAGAACGG - Intergenic
1124825545 15:33091044-33091066 TACTTCAAAAGAAAAATGAAAGG - Intronic
1125086271 15:35733653-35733675 TTCTTCAAAGAACAAATCAAAGG + Intergenic
1125552422 15:40555879-40555901 TTATTCAAAGTAAAAATCAATGG - Intronic
1126226838 15:46280639-46280661 TTCTGCAGATGAGAAAACTAAGG - Intergenic
1126315947 15:47369973-47369995 TTTTGCAGATGAAAAAACAGAGG + Intronic
1126483182 15:49150298-49150320 GTCTGCAAATAAATTATCAATGG - Intronic
1126672717 15:51130955-51130977 TTTTGAAAATGATACATCAAGGG + Intergenic
1126981737 15:54251520-54251542 TTTTGGAAATGAAAAATTTAAGG - Intronic
1127378340 15:58405789-58405811 CTCTGCAAGTGAAAAGTTAAAGG + Intronic
1128331826 15:66761076-66761098 TTCCTCAACTGAAAAATAAAAGG - Intronic
1128689189 15:69710329-69710351 TTCCTCAGATGTAAAATCAAAGG + Intergenic
1128819702 15:70640727-70640749 TTCTGCAAAATAAAAAAAAATGG + Intergenic
1128848081 15:70919270-70919292 TTCTGCAAAGTAAGAATCTACGG + Intronic
1128850808 15:70954263-70954285 TTCTGGAAATGAAAAATTCCAGG - Intronic
1129434742 15:75529603-75529625 TTTTTCAATTGAAAAATAAAGGG + Intronic
1129547232 15:76409372-76409394 TGCTGTAAATGATAAATAAATGG + Intronic
1129550416 15:76442680-76442702 TTATGCAAATGAGAAAACAGAGG + Intronic
1130732532 15:86512629-86512651 TTCTGAAAAAGAAAAAGCCAAGG - Intronic
1130810155 15:87368353-87368375 GTCTGCAAGTGAAAAAACCATGG - Intergenic
1131070971 15:89465641-89465663 TTCTCAAATTGACAAATCAAAGG - Intergenic
1131957987 15:97758166-97758188 TGCTGAAAGGGAAAAATCAATGG - Intergenic
1132073191 15:98797774-98797796 TTCTCCAAATGGAAAACAAATGG + Intronic
1132402905 15:101524429-101524451 TGCTGCAAAAGAAAAACCCACGG - Intronic
1133678781 16:8100781-8100803 TTCTGCAGCTCACAAATCAATGG - Intergenic
1133913024 16:10083162-10083184 TTCTGCAAATGACAAATGTGGGG - Intronic
1134559000 16:15191419-15191441 TTCTGCAGATGCCAAATCAAGGG + Intergenic
1134767764 16:16776405-16776427 TTCTAAAGATGAAAAACCAAAGG - Intergenic
1134790919 16:16988506-16988528 TGCTGAAAGTTAAAAATCAAGGG - Intergenic
1134919535 16:18103032-18103054 TTCTCCAGATGCCAAATCAAGGG + Intergenic
1135390221 16:22086613-22086635 TTCTACAGATGAAAAAACCAAGG - Intronic
1135804516 16:25530301-25530323 TTCTAAAAATTGAAAATCAATGG - Intergenic
1136224336 16:28848453-28848475 TTTTTCAAATGAAAACTCAGAGG + Intronic
1137462226 16:48675478-48675500 TTCTGCAACTGACAAATCAAGGG + Intergenic
1138162298 16:54765747-54765769 TTCTGAGAATAAAAAATCAGAGG + Intergenic
1138184953 16:54969520-54969542 TTGTGCAAAAGAAGAATCAGAGG + Intergenic
1138327249 16:56185040-56185062 ATCTTAAAAAGAAAAATCAATGG - Intergenic
1138328811 16:56195791-56195813 TTCTGGAAATGCTAAATAAAAGG - Intronic
1139190104 16:64853258-64853280 TTTTACAAATGAGAAAACAAAGG - Intergenic
1139503369 16:67386560-67386582 TTGGGCATTTGAAAAATCAATGG + Intergenic
1140290695 16:73652915-73652937 TTCTCCAATTAAAAAATAAATGG + Intergenic
1141140883 16:81496103-81496125 TTCTACAGATGAAAAAACAAAGG - Intronic
1141702156 16:85647444-85647466 TTCTGAAATTTAAAAATAAATGG + Intronic
1141759795 16:86020610-86020632 TTTTGCACATAAAAAAACAAAGG + Intergenic
1141838376 16:86558066-86558088 TTCTGGAAAAGAAAAAGCCATGG - Intergenic
1143469054 17:7160196-7160218 TTATGCAAATGAAAATTCCTGGG - Intergenic
1146379170 17:32315829-32315851 TCCTGCAAATGAGGAATGAATGG - Intronic
1146786206 17:35724115-35724137 TTGTACATATGAGAAATCAAGGG + Intronic
1147111254 17:38263510-38263532 ATCTGCAAATGAAAAACCTATGG + Intergenic
1147500549 17:40959208-40959230 TTCTGCAGATGAAAAACTAAAGG - Intronic
1148374407 17:47129392-47129414 ATTTGCAAATGAAAAATATAAGG - Exonic
1148418258 17:47524940-47524962 ATCTGCAAATGAAAAACCTATGG - Intronic
1149113321 17:53061632-53061654 TCCTGCCCATGAATAATCAAAGG - Intergenic
1149534489 17:57422028-57422050 TTCTACATATGAAAATTGAAAGG + Intronic
1150959594 17:69899169-69899191 TTCTGCAAATGAGAAAACTGAGG - Intergenic
1152359716 17:79826076-79826098 TTTTGCAGATGAAAAACCCAAGG + Intergenic
1152423439 17:80206105-80206127 TTTTCCCAGTGAAAAATCAAAGG + Intronic
1153266990 18:3280837-3280859 TTCTACAAATGAAATGTCAGGGG + Intergenic
1153387357 18:4512089-4512111 TCCTGAAAAAGAAAAATGAATGG - Intergenic
1154319755 18:13338233-13338255 TTCTGAAAAAGAAAAATCAAGGG - Intronic
1155096957 18:22565595-22565617 TCATGCATAGGAAAAATCAAAGG + Intergenic
1155163390 18:23213592-23213614 TACTGCAAAATAGAAATCAATGG + Intronic
1155264839 18:24081741-24081763 TTTTTTAAATGAAAAATTAATGG - Intronic
1155446658 18:25920129-25920151 GTCGGCAAAGTAAAAATCAATGG - Intergenic
1155752061 18:29437472-29437494 TTTTACAAATGAAAAAACAGAGG - Intergenic
1155849561 18:30753657-30753679 TCCTGGAAATGAAAAATTCAAGG + Intergenic
1156301774 18:35842542-35842564 TTCTGGAGATGAAAAATCCAAGG - Intergenic
1156886705 18:42142866-42142888 TTCTGGAATTGAAAAATTCAGGG + Intergenic
1156916957 18:42472896-42472918 TCCTGCAAATGAAACATAAAGGG + Intergenic
1157169098 18:45385647-45385669 TTCTGCAAATGAAAGAACTGAGG + Intronic
1157385363 18:47255461-47255483 TTTTGCAAATGAAGAAACAGGGG - Intergenic
1157728121 18:49980552-49980574 TCCTGGAAAAGAAAAATGAATGG + Exonic
1158064669 18:53391866-53391888 TTCTGCAAGTGCAAAATACAAGG + Exonic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1158801669 18:60918216-60918238 TTCAGAAATTGAAAAAGCAAAGG - Intergenic
1159265784 18:66076589-66076611 TTTTGCAAATGAAGAAACTAAGG - Intergenic
1160030457 18:75253451-75253473 TTCTGCAAATAAATAATCAATGG + Intronic
1160281030 18:77490804-77490826 TTTTGCAGATGAAGAATCCAAGG + Intergenic
1162632957 19:11943260-11943282 GTCTGCATATAAATAATCAAGGG - Intronic
1162703267 19:12535458-12535480 TTCTGCAAAAGACAAAACTATGG + Intronic
1163304144 19:16467005-16467027 TTCTGCAGATGAGAAAACTAAGG + Intronic
1163406976 19:17128856-17128878 TTTTGCAAACCAAAAAGCAAGGG + Intronic
1163677742 19:18663736-18663758 TTCCCCAAATGAAATAGCAAAGG + Intronic
1164141363 19:22468169-22468191 TTCTCAAAATGAAAAATTTACGG - Intronic
1164442546 19:28290316-28290338 TTCTGTAAATGACTAATCATGGG + Intergenic
1164533943 19:29070362-29070384 TTTTCAAAATGAAAAAGCAAGGG + Intergenic
1164984668 19:32639537-32639559 TTCTGCAAAAAAAATATCATTGG + Intronic
1165565440 19:36723284-36723306 GTCTGGAAATGCAAAATCAAAGG - Intronic
1166592806 19:44015929-44015951 TTATGCAAATGAAGACTCCATGG + Intergenic
1166842606 19:45707530-45707552 TTTTACAAATGAAAAATGCAAGG - Intergenic
1167027956 19:46935335-46935357 TACTTCAAATGACAAACCAAAGG - Intronic
1167193290 19:48007216-48007238 TTCTGCAGATGAGGAAACAAAGG + Intronic
925081091 2:1067741-1067763 TTCTCCATCTGAAAAATAAATGG - Intronic
925332397 2:3068721-3068743 TGCTGCAAATGAACATACAATGG + Intergenic
925535676 2:4913460-4913482 TTATACAAATGGAAAAACAAAGG - Intergenic
925664977 2:6243317-6243339 TTCTACACATGGAAAATAAATGG - Intergenic
925710710 2:6736905-6736927 TTCTGCAAGATAAACATCAATGG + Intergenic
925811276 2:7703200-7703222 TTATGCAAATGAAACCTCACAGG + Intergenic
925829819 2:7882956-7882978 CTTTGCAAATAAAAAGTCAAGGG + Intergenic
926118497 2:10228192-10228214 TCCTGCAAATGAAAGATGAGGGG - Intergenic
926792870 2:16593001-16593023 TTGTGCAAATGAAGAACCCAAGG - Intronic
927175694 2:20405547-20405569 TTCTGTAATAAAAAAATCAAGGG + Intergenic
928235103 2:29532397-29532419 TTTTGCAGATGAAAAATCGAAGG - Intronic
928582218 2:32720306-32720328 TTCTCAAAATGAACACTCAATGG + Intronic
929554916 2:42920207-42920229 TTCTGCAAATGAAACCTTAGGGG + Intergenic
929708358 2:44240010-44240032 TCTTGAAAATGAAAAATAAAAGG - Intronic
930310910 2:49738313-49738335 TTTTTCAAATGAGAAAACAAAGG + Intergenic
930402966 2:50914218-50914240 TGCTGAGAAAGAAAAATCAAAGG + Intronic
930601304 2:53446410-53446432 TTATGAATATGAAAAATGAAGGG - Intergenic
930631819 2:53761415-53761437 TCCTGCAAATGAAAAAAAAAAGG + Intronic
931271200 2:60704619-60704641 TTCTCAAAAGGAAAAATTAAAGG - Intergenic
931330656 2:61278639-61278661 TTCTACAAAAAAACAATCAATGG + Intronic
931945681 2:67304124-67304146 TTCTTCAAATGAATAAAGAATGG + Intergenic
932074865 2:68653454-68653476 TTCTTCAAATCAAAATTCCAAGG + Intronic
932263100 2:70343366-70343388 TTTTGCAGATGAAGAAACAAAGG - Intergenic
933359669 2:81264856-81264878 TTCTGGAAATGACAAAACTATGG - Intergenic
933412035 2:81938637-81938659 TAATGCAAATGAAACATCAAGGG + Intergenic
933414556 2:81969801-81969823 TTCTGTAAATAAAATATAAAAGG - Intergenic
933889353 2:86752628-86752650 TTCTACAGATGAAAAATCTAAGG + Intronic
934803347 2:97191295-97191317 TACTGCAAATGAAGAATCTCAGG - Intronic
934803780 2:97196901-97196923 TACTGCAAATGAAGAATCTCCGG - Intronic
935086380 2:99849510-99849532 TTCTACAAATGAAAAACGTATGG - Intronic
935535258 2:104285994-104286016 TTCTGTAAGTGAACAATCTAGGG - Intergenic
935606442 2:104976093-104976115 GTTTGCAAATGAAGAATAAAAGG + Intergenic
935811042 2:106797411-106797433 TTTGTCAAATGCAAAATCAATGG + Intergenic
936477084 2:112848736-112848758 TTCTGAAAAGGACAAATCACTGG - Intergenic
936810475 2:116394318-116394340 TTCTGCTGAAGAAATATCAATGG + Intergenic
937223479 2:120355249-120355271 TTGTGTAAATGAGAAAACAAAGG + Intergenic
937387103 2:121444965-121444987 TTAAGCAAATTAAAAAACAAGGG + Intronic
937567277 2:123309974-123309996 TTCTGTAAAAAAAAAGTCAATGG - Intergenic
937574003 2:123397092-123397114 TGCTAGAAAGGAAAAATCAAAGG - Intergenic
937658317 2:124402139-124402161 TTCAGAAAATGAAATATGAAGGG - Intronic
937810241 2:126191525-126191547 TTTTGCAAATGGAGAACCAATGG - Intergenic
937813875 2:126229645-126229667 TTCGAGGAATGAAAAATCAAAGG + Intergenic
938258932 2:129881513-129881535 TTCTGCAAATGAAATCACACTGG - Intergenic
938275223 2:130014672-130014694 TCCTGCACATGAATGATCAAAGG - Intergenic
938326185 2:130405396-130405418 TCCTGCACATGAATGATCAAAGG - Intergenic
938363753 2:130716063-130716085 TCCTGCACATGAATGATCAAAGG + Intergenic
938855946 2:135310681-135310703 TTTTTCATATGAAAAACCAAAGG + Intronic
939631624 2:144532964-144532986 TTCTCCTAGTGAAAAATCACAGG - Intergenic
939734351 2:145825519-145825541 ATCTGAAAAAAAAAAATCAAAGG - Intergenic
939845350 2:147237889-147237911 CTCAGCAAATGAAAAATAGAAGG - Intergenic
940307524 2:152242348-152242370 TTCTTCAAATGAAACATGATGGG - Intergenic
940759583 2:157722838-157722860 CTATGCAAATGAAAAAACAGTGG + Intergenic
940812075 2:158255945-158255967 TACTGCAAATAATAAATTAATGG + Intronic
940949481 2:159656542-159656564 TTCTGCAAAAGGTAAATCTATGG - Intergenic
941655392 2:168138336-168138358 TTCTGCAAAGTTAAAATCATGGG - Intronic
941740722 2:169032313-169032335 TTCTGCAAATTAAGAAGCACTGG - Intergenic
941815338 2:169790295-169790317 TTCTCCAAATCATAAATCATTGG + Intergenic
942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG + Exonic
942324375 2:174763506-174763528 TATTGGAAATGAAAAATCACAGG + Intronic
942363058 2:175193026-175193048 TTCTAAAAATTAAAAATTAACGG + Intergenic
942437621 2:175998090-175998112 TTTTACAAATGAGAAATCTAAGG + Intronic
942794408 2:179800303-179800325 TTCTGCAAATAATAAAGCAATGG + Intronic
942968848 2:181932012-181932034 ATGTGGAAATGAAAAATGAAAGG + Intergenic
943036967 2:182759213-182759235 TTCTACAAGGGAAAAATCATTGG + Exonic
943057995 2:183007476-183007498 TTCTTCCAAAGAAAAAGCAATGG + Intronic
943225938 2:185176031-185176053 TTTTTCAAATGAAATATAAATGG - Intergenic
943459146 2:188148488-188148510 TTCAGCAAATGAGAAATGATTGG - Intergenic
943700891 2:190987291-190987313 TTGTGCAAATGAACAATGTAAGG - Intronic
943814947 2:192241465-192241487 TAGTCCAAATGCAAAATCAATGG - Intergenic
945046969 2:205790147-205790169 TTCTGCACCTGGAGAATCAAAGG - Intronic
945641353 2:212434895-212434917 TTCTGCAAATGAATAAAAGATGG - Intronic
945832929 2:214808470-214808492 TTCTGCAAGTTAGAAATCAAAGG + Intronic
945847959 2:214970073-214970095 TTGAGCAAATGGAAAACCAATGG - Intronic
945890210 2:215422745-215422767 TTCTACAACTGGAAAATTAAAGG + Intronic
946538666 2:220659482-220659504 TTCTACAAAACAAAAGTCAACGG + Intergenic
946623045 2:221579487-221579509 TTCTGCAAAAGAAAAACCTGGGG - Intergenic
946788997 2:223280490-223280512 TATTAAAAATGAAAAATCAATGG - Intergenic
947033232 2:225821895-225821917 TTGTGCAAATGGAAAAACAAAGG - Intergenic
947284131 2:228492860-228492882 TTCTGAAAATAAGATATCAATGG + Intergenic
947377116 2:229507501-229507523 TTCTGGAAATTTCAAATCAATGG + Intronic
947482572 2:230514577-230514599 TTCTGCCAAAGAAAAATCATAGG + Intronic
947697238 2:232201957-232201979 TTCTTCAAATGAAAATTAAGGGG + Intronic
948189959 2:236050641-236050663 GTCTGAAAATGAAAAATGATTGG + Intronic
948278724 2:236729994-236730016 TTTTGAAAATGGAAAATAAAGGG - Intergenic
948721177 2:239901204-239901226 CTCTACAAATGAAACAACAATGG + Intronic
1168870400 20:1122605-1122627 TTCCTCTGATGAAAAATCAAAGG - Intronic
1169014107 20:2277868-2277890 TTTTGCAGACGAAAAAACAAAGG + Intergenic
1169157640 20:3346645-3346667 TTGTGCAAATGAAATAGAAAAGG + Intronic
1169202716 20:3720895-3720917 TTCTGAAAATTGAAAACCAACGG - Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1170219204 20:13924384-13924406 TCATCCAAATTAAAAATCAAAGG - Intronic
1170274753 20:14572782-14572804 TTCAGCACATGAAAATTCACTGG + Intronic
1170357991 20:15513051-15513073 TTCTACAAATTTAAACTCAAGGG + Intronic
1170825748 20:19793588-19793610 TTTCACAAATGAAAACTCAAAGG + Intergenic
1170975251 20:21157893-21157915 TCTTGAAAATGAAAAATTAAAGG + Intronic
1171424851 20:25042947-25042969 TTTTGCAAATGAGAAAACCAAGG + Intronic
1172260649 20:33561527-33561549 TTCTGCTAAATAAAAATCGAAGG - Intronic
1172702204 20:36860723-36860745 TTTTACAAATGAGAAAGCAAAGG + Intronic
1172928332 20:38561653-38561675 CCTTGCAAATGAAAAATAAAAGG - Intronic
1173106950 20:40145744-40145766 TTATTCAACTGAAAAATGAAAGG - Intergenic
1173307528 20:41864234-41864256 TTCTGCAAATGAAGACTTACGGG - Intergenic
1174104272 20:48151066-48151088 TTCTGTAAATGAAAGCTCGAAGG - Intergenic
1174312061 20:49664969-49664991 TTTTCCAAAAGAAAAATAAAAGG + Intronic
1174442034 20:50563431-50563453 TTTAGCAAATGAAAAAACCAAGG + Intronic
1174783342 20:53410640-53410662 TTATGAAAATGTAAAATCCATGG + Intronic
1174908877 20:54584930-54584952 TTTTGCAAATGAGAAAACCAAGG - Intronic
1175356527 20:58373381-58373403 TGCTGCAAATTAAGAATCACAGG + Intergenic
1175949933 20:62577962-62577984 TTCTGCAGATGACAAAACCAAGG - Intergenic
1176904763 21:14486329-14486351 AACTGCAAATGAACAATGAAGGG - Intronic
1177097498 21:16855119-16855141 TCCTTCAAGTGAAAAATAAAAGG - Intergenic
1177421108 21:20858952-20858974 TTATGCAAAAGAAAAATAACAGG + Intergenic
1178274339 21:31223171-31223193 TTGTGCAAAGGAAATATGAAGGG - Intronic
1178350964 21:31873094-31873116 TTCTGCAAATTCAAACTGAATGG + Intergenic
1178793786 21:35724253-35724275 TTCTACAAATTAAAACTCAGAGG - Intronic
1179020821 21:37639215-37639237 TCCTCCTAGTGAAAAATCAAAGG - Intronic
1179162834 21:38912102-38912124 TTCTTCATCTGAAAAATGAAGGG - Intergenic
1180669770 22:17543921-17543943 TTTTACAGATGAAAAATCCAAGG + Intronic
1180673428 22:17570861-17570883 TGCTGCAACTGAATATTCAATGG + Intronic
1182914859 22:34020103-34020125 TCCTGAAAATGAAATATCATTGG - Intergenic
1183130053 22:35825624-35825646 TTTTGCAGATGAAAAACCGAAGG - Intronic
1183223802 22:36535238-36535260 TTGTTAAAATGAAAACTCAAGGG - Intergenic
1183793072 22:40089896-40089918 ATCTGGAAAAGAAAAATCTACGG - Intronic
1184082502 22:42233280-42233302 TTCTGCAGATGAGGAAACAAAGG + Intronic
1184574702 22:45353721-45353743 TTCTTCATCTGAAAAATAAATGG - Intronic
1184619615 22:45666296-45666318 TTTTACAAATGAAAAAAAAAAGG + Intergenic
1184994853 22:48198077-48198099 GTCTGCAAATCAAAACTAAAGGG - Intergenic
1203325893 22_KI270738v1_random:17316-17338 TTTTGAAAATGAAAAGACAAAGG - Intergenic
949104249 3:184291-184313 CTCTGCAAATAAAGAATCAGGGG - Intergenic
949157295 3:844660-844682 TTCTCTACATGAAAAATAAAAGG - Intergenic
949456970 3:4249183-4249205 TTCAGCAAATCAAATATCAAAGG + Intronic
949500387 3:4674641-4674663 TTCTGCAAATGATTAAGCTATGG - Intronic
949524774 3:4892555-4892577 TCCTGAAAATAAAAAAACAAGGG + Intergenic
950114781 3:10443696-10443718 TTGTGCAACTGAAAACTCCAGGG - Intronic
950464242 3:13143867-13143889 TTATGCAACTAAAAAATCTAAGG - Intergenic
950505574 3:13392458-13392480 TTGAGCAAATGAAAACTCTATGG + Intronic
950543025 3:13623370-13623392 TTCTGGGAATGAAAGAGCAAGGG + Intronic
950762616 3:15246474-15246496 TTCTGCATCTGAAAAAGGAATGG - Intronic
952075096 3:29686171-29686193 TGAAGCAAATGAAAACTCAAGGG - Intronic
952080365 3:29751023-29751045 TTGTGAAAATGATAATTCAAAGG + Intronic
952653600 3:35756779-35756801 TTCTGAGAATAAAAAATAAATGG + Intronic
953204702 3:40814883-40814905 TACTGGCAATGAAAAATCAAGGG + Intergenic
953480300 3:43245729-43245751 TTCTGCAGATGAAAATTCCAAGG - Intergenic
953532968 3:43754717-43754739 TAATGCAAATAAAAAACCAATGG + Intergenic
953801215 3:46024080-46024102 TTCTGGAGATGTAAAATCCAAGG - Intronic
953962408 3:47276727-47276749 TTCTTCAAAGGAAAAATTCAAGG - Intronic
953966895 3:47315107-47315129 ATCAGCAAATGAGAAATCAATGG + Intronic
954541784 3:51397911-51397933 TTGTGGAAATTACAAATCAAAGG - Intronic
954951806 3:54481281-54481303 CTGTGCAAATGAAACATCAGAGG - Intronic
955039444 3:55300987-55301009 TTTTACAGATGGAAAATCAATGG - Intergenic
955087426 3:55716836-55716858 TACTGGAAATGTAAAATAAATGG - Intronic
955984659 3:64560110-64560132 TTCTACAAATGGATAATCCAAGG + Intronic
956099265 3:65750102-65750124 TTCTGCAAATTAAAACCAAATGG + Intronic
956321803 3:68006395-68006417 TTCTGCAAAACAAAACTCCAAGG - Intronic
956670934 3:71689143-71689165 TACTGAAAAAGAAAAATAAAAGG - Intronic
956808761 3:72843856-72843878 TTCTATAAAGGAAAAATAAATGG + Intronic
956866975 3:73379014-73379036 TTCTGCAATTTAGAACTCAAAGG + Intergenic
957129723 3:76207668-76207690 ATTGACAAATGAAAAATCAATGG + Intronic
957304039 3:78432875-78432897 TTCTACAAATGAAAGATCTGTGG - Intergenic
958047994 3:88308241-88308263 TTTGGCATTTGAAAAATCAAAGG + Intergenic
958458371 3:94362280-94362302 TTCAGGAAATAAAAAATTAAAGG + Intergenic
958554087 3:95651112-95651134 TAATGCAAATGACAAATTAATGG + Intergenic
958668339 3:97169740-97169762 TTATTCAAATGAAAAAACTAAGG - Intronic
958707420 3:97673420-97673442 TTCCACAAATGAAAAGTGAATGG - Intronic
958901436 3:99891797-99891819 TTAGGCAACTGAAAAATCACTGG - Intronic
959011422 3:101081346-101081368 TTCTGAAAAAGACAAATCTATGG + Intergenic
959282757 3:104366256-104366278 TTCTGCAAGTGAATATACAAAGG + Intergenic
960485670 3:118250005-118250027 TTTAGCAAATGAAAAATACAGGG - Intergenic
961115998 3:124330551-124330573 CTCTTCCATTGAAAAATCAAAGG + Intronic
961339605 3:126209171-126209193 TTCTGCAAATGGAAAAACTGAGG + Intergenic
961599012 3:128044301-128044323 TCCTGTAACTGAAAAGTCAAAGG - Intergenic
961901728 3:130219565-130219587 TGCTGCAAATAAAGAATGAATGG + Intergenic
962184110 3:133240131-133240153 TTTTGCAAATCAAAAATTAGAGG + Intronic
962465197 3:135650997-135651019 TTTTAGAAATGAAAAATAAAAGG + Intergenic
962590604 3:136886245-136886267 TACTGCAAAAGAAAAAAAAAAGG - Intronic
962658682 3:137577653-137577675 TTCTACAAATGAATCATAAAAGG - Intergenic
962759852 3:138500223-138500245 ATCTGCAAAAGAGAAATAAAAGG + Exonic
962816349 3:139004778-139004800 TTCTGCAAATAAGAATTTAAGGG - Intergenic
962877703 3:139548464-139548486 TTCTGAAAATGAAGACCCAATGG - Intergenic
962982209 3:140500720-140500742 TTCTACAAATGAAAAAAGTAAGG - Intronic
963143090 3:141964213-141964235 TTCAGCAAATGACACAGCAAGGG + Intronic
963593627 3:147297434-147297456 TTTTCCAAAGGAAAAAACAAAGG + Intergenic
964665424 3:159166727-159166749 TTATGCAAAGGAAAAATTGAAGG + Intronic
965149873 3:164958515-164958537 TTCTGCAAAGCAAAAATGTAAGG + Intergenic
965199877 3:165644043-165644065 TTATGTAATTGAAAAATCACAGG + Intergenic
965885053 3:173435208-173435230 TTGTTCAACAGAAAAATCAATGG - Intronic
965908476 3:173740779-173740801 TTTTGGAATTGAAAAATAAAAGG + Intronic
965994117 3:174858004-174858026 TTTTTCAAATTAAAAAGCAATGG + Intronic
966525880 3:180918667-180918689 TACTGCATATGAAAAAACCAAGG - Intronic
966570008 3:181430660-181430682 TTTTACAAAGGAAAAATAAAAGG - Intergenic
967085569 3:186092202-186092224 TTCTGAAAATGGAAATCCAAAGG + Intronic
967161547 3:186743366-186743388 TTCTGCTTCTCAAAAATCAATGG - Exonic
967764802 3:193267413-193267435 TTCTGCAAATGGGAAAACTATGG - Intronic
968023346 3:195415944-195415966 TTCTACAAATCAAAAAGAAATGG + Intronic
968389079 4:174012-174034 TCCTGCACATGAATGATCAAAGG + Intergenic
970027189 4:11636030-11636052 TTCTGCTAATGAGCCATCAAGGG - Intergenic
970276941 4:14411393-14411415 TACTAGACATGAAAAATCAATGG + Intergenic
970382950 4:15526312-15526334 TTCTACACATGAAAAATTAGAGG + Intronic
970806472 4:20041449-20041471 TGCTGAAAAGGAAAAATAAAAGG - Intergenic
970993949 4:22244351-22244373 TTCTTCAGATGAAAAAACAGAGG + Intergenic
971144530 4:23962354-23962376 TTCTACAAATGAGAAAGCTAAGG + Intergenic
972303903 4:37813141-37813163 TTTTATAAATGAGAAATCAAAGG - Intergenic
972355958 4:38279773-38279795 CACTGCAAATGAAACTTCAAAGG + Intergenic
972703774 4:41520017-41520039 TTCTGCTTATTAAAAATCATAGG - Intronic
972814323 4:42627803-42627825 GTCTTCTAGTGAAAAATCAAAGG + Intronic
973856912 4:55020667-55020689 TTTTGCAGTTGAAAAATCAATGG + Intergenic
973885093 4:55312833-55312855 TTCAGTAAATGAAAAGTCCAGGG - Intergenic
974491932 4:62575330-62575352 GTATGCTAATCAAAAATCAAAGG - Intergenic
974611766 4:64227442-64227464 TTCTGCTGAGGAAAAATCAAGGG + Intergenic
974927573 4:68319339-68319361 CACTGAAAATGAAAAATCGATGG + Intronic
974955989 4:68642070-68642092 GTCTCCAAATACAAAATCAATGG - Intronic
975653828 4:76621100-76621122 AGGTGGAAATGAAAAATCAATGG - Intronic
975657720 4:76658317-76658339 TTCTAAAAATGGAAAATCAAAGG + Intronic
975870998 4:78777591-78777613 TTTTGCAACTAAAAACTCAAAGG - Intronic
975960129 4:79892729-79892751 TTGTGAGAATGAAAAATAAATGG - Intergenic
975972092 4:80051738-80051760 TTTTACAACTCAAAAATCAAGGG - Intronic
976101609 4:81569886-81569908 CACTGCAAATGCAAAAGCAATGG - Intronic
976778847 4:88736596-88736618 CTCTAGAGATGAAAAATCAAAGG - Intronic
977574436 4:98660893-98660915 GTCTTAAAAAGAAAAATCAATGG + Intergenic
977855391 4:101884784-101884806 TTAGGCAAAAGAAAAATCGATGG - Intronic
978393717 4:108255301-108255323 TTCTGCAATGGAAAACTCCAAGG + Intergenic
978659098 4:111101784-111101806 TTCTGGAAAAGACAAAACAATGG + Intergenic
978790215 4:112655335-112655357 TTTTTAAAATGAAAAATAAAAGG - Intronic
978967341 4:114756786-114756808 TTTTGAAAAGGAAGAATCAAAGG + Intergenic
979817918 4:125133246-125133268 TACTGGAAATGAAAAAACTAAGG + Intergenic
979969646 4:127118269-127118291 TTCTGCAAATGTAAAGTGAAAGG + Intergenic
980034611 4:127869390-127869412 TTCTGCAAAGGAAAAAAAATCGG - Intergenic
980220436 4:129906542-129906564 TTTTTCAAATGAAAAACTAAAGG - Intergenic
980463096 4:133143702-133143724 TTCTGTATTTTAAAAATCAAGGG + Intergenic
980517064 4:133877512-133877534 TTCTGGTACTGAAAAATCCAAGG - Intergenic
980652996 4:135745455-135745477 TCCTCCAAATCCAAAATCAAAGG - Intergenic
981183299 4:141770764-141770786 TTCTGTTTATGAAAATTCAATGG + Intergenic
981701482 4:147611760-147611782 GTCTGAAAATAAAACATCAATGG + Intergenic
982211902 4:153044550-153044572 TTCTGGAAAAGGAAAATCAATGG + Intergenic
982344029 4:154336156-154336178 TTCAGCAAATGTAAAGACAATGG + Intronic
982495138 4:156081591-156081613 CTCTGAAAATGAAAAGTAAATGG - Intergenic
982643875 4:157997661-157997683 TTCTGCAAAAGAAAAATCACTGG + Intergenic
982649346 4:158067253-158067275 TTCTGCAAAGGAAAATAAAATGG - Intergenic
982807339 4:159782726-159782748 TTCTGGAAATGACAAAACTAAGG - Intergenic
982962523 4:161858489-161858511 TTATGCAAATCAAAATCCAATGG + Intronic
983086431 4:163450558-163450580 TTCTGCAACCCATAAATCAAGGG - Intergenic
983341977 4:166472561-166472583 CTTTGCAAAAAAAAAATCAATGG - Intergenic
983350390 4:166579474-166579496 CTCTTCAAATATAAAATCAAAGG - Intergenic
984223061 4:177001822-177001844 ATCTGCAAATGTAAAGTCAGAGG + Intergenic
984241289 4:177222834-177222856 TTCATAAAATGAAAAATCAGAGG + Intergenic
984336884 4:178403704-178403726 TGCTGGAAATGTAAAATCACTGG - Intergenic
984513409 4:180708045-180708067 TTATACAAATGAAAATTCCAGGG - Intergenic
984676357 4:182552355-182552377 TTCAGTAAATGAAGAATTAATGG - Intronic
986834098 5:11615578-11615600 TTCCTCATTTGAAAAATCAAGGG - Intronic
987375903 5:17234438-17234460 TTCTTTAAATGAAACATCAGTGG + Intronic
987562980 5:19548641-19548663 TTTTGCAAATGAAGAAACGAAGG + Intronic
988185652 5:27858309-27858331 TTCTAAAAATGAAAACCCAAGGG + Intergenic
988624305 5:32854793-32854815 AACTAAAAATGAAAAATCAAGGG + Intergenic
989155464 5:38340708-38340730 TTCTGCAAAGGCAGACTCAAGGG + Intronic
989258097 5:39388171-39388193 TTTTGCAAATGAAGTGTCAATGG - Intronic
989303415 5:39921933-39921955 TTCTGCTCATGTAAAATTAATGG + Intergenic
989502651 5:42186848-42186870 TTTTGGAAATAAAAAATCTAAGG - Intergenic
989637807 5:43555998-43556020 CTCTGCAAAAGAAAAAAAAACGG + Exonic
989684207 5:44065522-44065544 TTCTACAAATGATAAAACCAAGG + Intergenic
989799965 5:45525654-45525676 TTCTGCAAATGAGAAATAGGAGG + Intronic
990420693 5:55630282-55630304 TTTTGCAAATGTAAATTAAAGGG + Intronic
991273972 5:64821617-64821639 TTCTGCAAAACAAAAAACTAAGG - Intronic
991455891 5:66804042-66804064 TTCTGAAAATGTAAGATTAATGG - Intronic
992486334 5:77200525-77200547 TTCAGAAAATGAAACATCACAGG + Intergenic
992604852 5:78444894-78444916 TTTTGCAAATGGAAAATCTCAGG + Intronic
993407438 5:87529094-87529116 TTCTGGCAAAGAACAATCAATGG + Intergenic
993640927 5:90404392-90404414 TTCTACAAATAAACAATCTAAGG + Intronic
993670084 5:90749677-90749699 TACTGCATATGGAAAATCCAGGG + Intronic
994058032 5:95441599-95441621 GTCTGCAAATTAAAAAAAAAAGG + Intronic
994179469 5:96748254-96748276 TTCTGAAACTGAAACATCAAGGG + Intronic
994402798 5:99303019-99303041 TTCTGTAAAGAAAATATCAAGGG - Intergenic
994648831 5:102502196-102502218 TTTTACAAATGAAGAATTAAGGG - Intergenic
995008726 5:107233281-107233303 TTCTGGAATTGAAAAATGGATGG - Intergenic
995297589 5:110538937-110538959 TTCTCAAATTGACAAATCAAAGG - Intronic
995456353 5:112356787-112356809 TGGTGAAAAAGAAAAATCAAAGG + Intronic
995529802 5:113081330-113081352 TTTTGCAAATGAGAAAACAAAGG - Intronic
995840983 5:116443011-116443033 TTTTGCCAAAGAAAAATCAAAGG + Intergenic
996163261 5:120193845-120193867 TTCTACAGATGAGAAATCAGAGG + Intergenic
996354508 5:122580977-122580999 TTTTTCCATTGAAAAATCAAAGG - Intergenic
996834283 5:127773921-127773943 TTTTTCAAATGGAAAATAAAAGG - Intergenic
996981360 5:129499575-129499597 TCCTACAAATGAAAAATATATGG - Intronic
997942566 5:138171772-138171794 TTTTACAAATGAAAAAACAGAGG + Intronic
998180840 5:139939668-139939690 TTATGAAAATGAAAAGGCAAAGG + Intronic
998441071 5:142162644-142162666 TTCTGCAGCTGAAAAAAAAATGG + Intergenic
998505586 5:142669528-142669550 TTCTGCAAAGGAGTAATCAGAGG + Intronic
998677535 5:144426416-144426438 TTTTGCAAATGAAGCATTAAGGG - Intronic
998891822 5:146754280-146754302 TTCTGCAGATGACACAGCAATGG - Intronic
999271870 5:150301431-150301453 TTTTGCAGATGAAAAAACAGAGG + Intronic
999398661 5:151247898-151247920 TTCTCAAATTGACAAATCAAAGG + Intronic
999965332 5:156803378-156803400 TCTTGCAGGTGAAAAATCAAAGG + Intergenic
1000258474 5:159563242-159563264 TTTTACAGATGAAAAAGCAAAGG - Intergenic
1000728078 5:164797372-164797394 TTGCACAAATGAATAATCAATGG + Intergenic
1000811993 5:165874619-165874641 TTTTGAAAATAAAAAAGCAATGG + Intergenic
1001899261 5:175410422-175410444 TTCTGCAAATGAATATCCAATGG + Intergenic
1001970391 5:175950632-175950654 TTTTACAAATGAAAAAACTAAGG + Intronic
1002247046 5:177893129-177893151 TTTTACAAATGAAAAAACTAAGG - Intergenic
1003144419 6:3497912-3497934 ATCTACAAATCCAAAATCAAAGG - Intergenic
1003684546 6:8288170-8288192 TTCTGCAAAAGGAAAAACTATGG - Intergenic
1004871110 6:19904968-19904990 TTCTGTAAAGGCAAAACCAAAGG - Intergenic
1004878168 6:19977262-19977284 TTCAGCAAAGGAAAAACAAAAGG - Intergenic
1004883864 6:20033701-20033723 ATCTGAAAGTGAAAAGTCAATGG + Intergenic
1005213551 6:23497824-23497846 TCCTACAGATGAAAAATCTATGG - Intergenic
1005429102 6:25735439-25735461 TTCTGCAAAAGACCAAACAAGGG + Intergenic
1006928165 6:37670506-37670528 TTTTGCAAATGAGAAAACTAAGG - Intronic
1007418851 6:41707386-41707408 GTTTGGAAATGAAACATCAAGGG + Intronic
1007796781 6:44355212-44355234 TTCTGGAAAGGAAAAAACTATGG - Intronic
1007853356 6:44827501-44827523 TCTTGCAAATGAAAAAACCATGG - Intronic
1008004353 6:46394317-46394339 TTGTGCAAATGCCAAATCATAGG - Intronic
1008162294 6:48093249-48093271 TTCTTCACCTGAAAAATGAAGGG - Intergenic
1008164393 6:48118185-48118207 TTTTCTAAATGAAAAAACAAAGG - Intergenic
1008229231 6:48963766-48963788 TTCTGCAAACGATAAAGAAAAGG + Intergenic
1008405181 6:51111231-51111253 TTTTGCAAATGAAGGATCTAAGG + Intergenic
1008651849 6:53572088-53572110 TTCAGTAAATAAAAAATAAATGG - Intronic
1009273992 6:61651590-61651612 TTTTACAAATGAAAAAACAGAGG + Intergenic
1009492214 6:64305347-64305369 TTCTGAAAAAAAAAAATCACTGG - Intronic
1009730675 6:67600957-67600979 TTATGGGAAAGAAAAATCAAAGG - Intergenic
1009830024 6:68918410-68918432 TTCTGAAAATACAAAATCACTGG + Intronic
1009854659 6:69246590-69246612 ATCTGGAAATGAATAATCAAGGG - Intronic
1010027389 6:71235323-71235345 TAATGCAAATGAAAAAAGAATGG - Intergenic
1010478128 6:76315061-76315083 TTTTGCAAATGAGAAAACTAAGG + Intergenic
1010563496 6:77380565-77380587 TTCTGCAAAAAAAAAATCATTGG - Intergenic
1011350846 6:86422098-86422120 TTTTGCAAATGAAGAATCCAGGG - Intergenic
1011656504 6:89556834-89556856 TTCTGCACATGTAAAATAGAAGG - Intronic
1011813459 6:91160041-91160063 TACTGCGAAAGAAAAATCACTGG - Intergenic
1012829201 6:104185221-104185243 TTATGGAAGTGAAAAAGCAATGG - Intergenic
1013767187 6:113588926-113588948 CTCTGGAAATGAAAATCCAAGGG + Intergenic
1013813861 6:114074425-114074447 ATGTGCAAAAGAAAAATAAATGG - Intronic
1013841005 6:114393755-114393777 CTCTGCAAATGAAGAAAGAAAGG - Intergenic
1013921523 6:115410758-115410780 TTCTGCAAATAAGAAAGAAAAGG + Intergenic
1014528221 6:122526455-122526477 TTCTGCAACTCATAGATCAAGGG - Intronic
1015208359 6:130667453-130667475 TTCTGAAAATAAACAATAAAAGG - Intergenic
1015286484 6:131491150-131491172 TGTTGGAAATGTAAAATCAAAGG + Intergenic
1015398410 6:132760910-132760932 TGCTTCAAATAAAAAAACAAAGG - Intronic
1015667075 6:135644000-135644022 TTTTGCAAATAGAAAATCAATGG + Intergenic
1016111133 6:140225519-140225541 TCCAGCAAAAGAAAAATGAAAGG + Intergenic
1016153755 6:140777908-140777930 TTGTGCAAATTAAAAGACAATGG + Intergenic
1016223174 6:141701256-141701278 TTCTACAAAAGAAAAATCAGAGG + Intergenic
1016528071 6:145025896-145025918 TTCTTTAAATGAAAATTCCATGG + Intergenic
1016637780 6:146314732-146314754 ATCTGCAAATAAAAAAAAAATGG - Intronic
1017661402 6:156677639-156677661 TTCTGGAAAAGGAAAAACAATGG + Intergenic
1018205455 6:161433454-161433476 TTCTAGAAATTAAAAATTAAAGG + Intronic
1018335855 6:162788216-162788238 TTCTGGAAAAGAAAAAACTATGG - Intronic
1018715055 6:166525669-166525691 TTTTGAAAAAGAAAAATGAAAGG - Intronic
1018745287 6:166757199-166757221 TTCTGCAAGTGCAGAAGCAAAGG - Intronic
1019061189 6:169259420-169259442 TTCTACAGAGGAGAAATCAAAGG + Intergenic
1020109998 7:5442705-5442727 TTTTTTAAATGAAAAATAAAAGG + Intronic
1020427702 7:8088196-8088218 TTCTTAAAAAAAAAAATCAATGG - Exonic
1020778407 7:12486596-12486618 TTTTAAAAATGTAAAATCAATGG - Intergenic
1020953641 7:14711785-14711807 TTCTGCAAAAGTGAAATGAAAGG + Intronic
1021311322 7:19101408-19101430 AAATGCAAACGAAAAATCAAAGG - Intronic
1021490785 7:21218447-21218469 TTCTCTAAATGGAAAATCAAAGG - Intergenic
1021615017 7:22493778-22493800 TGCTGCAAATGCAAAAGCACAGG + Exonic
1021647161 7:22799729-22799751 TTTTGCAAATGAAACAGCCATGG - Intergenic
1021681329 7:23136154-23136176 TGCTGCAGATAAAAAATTAATGG - Intronic
1021812417 7:24415743-24415765 TTCTGGCAATGTAAAATTAAAGG + Intergenic
1022048960 7:26646466-26646488 GTCTTCAGATGAAAAATGAAAGG - Exonic
1022138447 7:27471177-27471199 ATCTGTAAGTGAAAAATAAAGGG + Intergenic
1022251248 7:28610605-28610627 TTCTTCAAATGAAAAATGGATGG + Intronic
1023465944 7:40454858-40454880 TTCTGTAAATGAAAAATTCCTGG - Intronic
1023469470 7:40498961-40498983 TACGGAAAATGAAAAATAAAAGG - Intronic
1024465253 7:49705486-49705508 ATCTGCAAAGGAAATATCAAAGG + Intergenic
1024573294 7:50743255-50743277 TGCTGAGAATAAAAAATCAAAGG - Intronic
1025306095 7:57858084-57858106 TTTTGAAAATGAAAAGGCAAAGG - Intergenic
1025319251 7:58075578-58075600 TTTTGAAAATGAAAAGACAAAGG + Intergenic
1026591980 7:71704487-71704509 TTCTGCAAAAAAAAAAAAAAAGG - Intronic
1027133329 7:75606889-75606911 TTCTGCAGATGAAGAAACCAAGG + Intronic
1027424020 7:78044170-78044192 TTCTGAAAAGGAAACATTAATGG - Intronic
1027594574 7:80157164-80157186 TTCTGGAAAAGAAAAAACTATGG - Intronic
1028154528 7:87414749-87414771 TATTACAAATGAAAAATCTATGG - Intronic
1028843614 7:95454638-95454660 TTATGCAAATGGAATCTCAAGGG + Intergenic
1029021133 7:97365583-97365605 TTCTGAAACTGAAAAATCCATGG + Intergenic
1029048164 7:97653531-97653553 TTTTACAAATGAGAAAACAAAGG - Intergenic
1029550243 7:101233486-101233508 TTCTGCAAATTGAAAAGCAATGG + Intronic
1029913802 7:104184888-104184910 TTGTGCAAATGAAACCTCATAGG - Intronic
1030093180 7:105875879-105875901 ATCTGCAGATGAAAAAGAAAAGG + Exonic
1030504767 7:110407569-110407591 CTATGAAAATGAAAAATAAATGG + Intergenic
1030756918 7:113297132-113297154 TTATCCAAAGGAAAGATCAAAGG + Intergenic
1030853589 7:114522196-114522218 TTGTGCTAATGCAAAATGAAGGG + Intronic
1031116496 7:117674558-117674580 TGCTGCCAATGAAAAGGCAAAGG - Intronic
1031131542 7:117838714-117838736 TTTTGTAAAGGCAAAATCAAAGG - Intronic
1031159408 7:118148392-118148414 TTCTTCAAATGGAACATGAAAGG + Intergenic
1031337886 7:120559409-120559431 TTCTGCAGATGAGAACACAAAGG + Intronic
1031363317 7:120873309-120873331 TTCTGCAAATGAAAGAATATAGG - Intergenic
1031873995 7:127117515-127117537 TTCTTCAAAAGAAAAATTAGGGG + Intronic
1032537864 7:132679301-132679323 TTTTGCAGATGAGAAAACAAAGG - Intronic
1032581833 7:133110766-133110788 TTCTGGATATGTCAAATCAATGG - Intergenic
1033250407 7:139753694-139753716 TTCTGAAAATGATCACTCAAGGG + Intronic
1033335140 7:140445875-140445897 TTTTGCAAATGAAAAAACTAAGG - Intergenic
1035180044 7:157082732-157082754 TTCAGCAAAAGAAAAAAAAAAGG + Intergenic
1035973584 8:4281871-4281893 TTTTGCAAATGACAAGGCAAAGG + Intronic
1036048466 8:5169573-5169595 TTCTGCAGTTTAAAAATTAATGG + Intergenic
1036215523 8:6877077-6877099 TTCTGCAGATGAATAAACCAAGG + Intronic
1036916847 8:12812393-12812415 CTCAGCAAGTGAATAATCAATGG - Intergenic
1037137704 8:15483185-15483207 TTTTGCAAAAGAAAAAGAAATGG + Intronic
1037211664 8:16395873-16395895 TTCTGCAATTCCAAAATCCAAGG + Intronic
1037286622 8:17308165-17308187 TACTGCAAATCAAAAAAAAAAGG + Intronic
1037531994 8:19785758-19785780 TTTTGCAGATGAAAAAACTAAGG - Intergenic
1038318332 8:26507126-26507148 TTCTTAAAAAGAAAAATCAAGGG + Exonic
1039124453 8:34185498-34185520 TTATGCAAATGATAAAACAAAGG - Intergenic
1039191842 8:34985102-34985124 TTCTGGCCAAGAAAAATCAATGG - Intergenic
1039423742 8:37468089-37468111 TTTTGAAAATGAAAAATAGAAGG - Intergenic
1039673566 8:39633351-39633373 TACTGCAAATGGAGAATGAAGGG + Intronic
1041464058 8:58141642-58141664 TTCTGGTAATGAAAAAGAAAAGG - Intronic
1041593121 8:59614104-59614126 TTCTCCAAAGGAAAAATTACAGG + Intergenic
1041932551 8:63302859-63302881 TTTTGCAAACAAAAAATCAAGGG - Intergenic
1041966780 8:63687295-63687317 TATTTCAAATGAAAAATAAATGG - Intergenic
1043094532 8:75949646-75949668 TTAAGCAAATGAAAAGACAAAGG + Intergenic
1043286349 8:78536586-78536608 TTCTGAAATGGAAAAATCCAAGG + Intronic
1043821713 8:84874330-84874352 TTTTGCAGATGAGAAAACAAAGG + Intronic
1044019278 8:87084507-87084529 TTATGCAAATCAAAACACAATGG - Intronic
1044337905 8:91009977-91009999 ATCTGCAAATGTCAAACCAAGGG + Intronic
1044422767 8:92017147-92017169 TTCTGCAAATGAAAAATCAAGGG - Intronic
1044826671 8:96204852-96204874 TTTAAAAAATGAAAAATCAAGGG - Intergenic
1044830109 8:96238858-96238880 TTTTACAAATAAAAAAGCAAAGG + Intergenic
1045199120 8:99961195-99961217 TCCTGCAAAGGAAACATAAATGG + Exonic
1045567570 8:103336817-103336839 TTCTGCACATGACAGATCACAGG - Intergenic
1045610244 8:103831780-103831802 TTCAGCAAAAGAATAATCACTGG - Intronic
1045962469 8:107983895-107983917 TTCTGTAGATGGAAAATCCAAGG - Intronic
1046023628 8:108696318-108696340 TATTGCAAATGAAAAATCTGAGG + Intronic
1046083236 8:109398011-109398033 TTCTTCAAATGAAAAAAAAAGGG - Intronic
1046291795 8:112172030-112172052 CTTTGCATATGAAGAATCAAAGG + Intergenic
1046836594 8:118808638-118808660 TTCTGCAGATGAAATATCTGAGG - Intergenic
1047161153 8:122381451-122381473 TTCTGGAATTGACAAAACAAAGG - Intergenic
1047559796 8:125974104-125974126 TGATGCAAATGACAAATCATAGG - Intergenic
1048131172 8:131699339-131699361 GTCTGCTACTGAAAAATCACAGG - Intergenic
1048619024 8:136110960-136110982 TTCTGCAATTCTAAAATGAAAGG - Intergenic
1048648546 8:136449499-136449521 TTCTACAACTGAAATATCATGGG + Intergenic
1048983528 8:139716236-139716258 TTCAAAAAATTAAAAATCAATGG + Intergenic
1049366586 8:142240132-142240154 TACTGAAAATGAAAAATAACAGG + Intronic
1050271811 9:3954197-3954219 TTCTCCAAATGCAAAAAGAAAGG - Intronic
1050301956 9:4268194-4268216 TTTTACAAATGAAAAAACTAAGG - Intronic
1050494156 9:6222120-6222142 TTATGGAAATGAAATATCCAGGG + Intronic
1050679432 9:8093049-8093071 CTCTGTTACTGAAAAATCAATGG - Intergenic
1051213957 9:14776310-14776332 TGACTCAAATGAAAAATCAAGGG + Intronic
1051240088 9:15045137-15045159 TACTGAAAATGCAAAACCAATGG + Intergenic
1051351096 9:16198547-16198569 TTTTACAGATGAAAAATCTAAGG + Intergenic
1052030997 9:23628829-23628851 ATCTGCAAAGGAACATTCAATGG + Intergenic
1053085478 9:35216949-35216971 TTCTGCAAATGACAAAATGATGG + Intronic
1053271757 9:36754821-36754843 TAAGGAAAATGAAAAATCAAGGG - Intergenic
1053490950 9:38501949-38501971 ATCTGAAAAAGAAAAATCAGAGG - Intergenic
1053826588 9:42030956-42030978 TTTTGCAAATGAAAGATTGAAGG - Intronic
1054603972 9:67156467-67156489 TTTTGCAAATGAAAGATTGAAGG + Intergenic
1054744292 9:68839230-68839252 TTTTGCAAATGAAGAAGCATAGG - Intronic
1055040213 9:71862600-71862622 TTCTGCACCTGTAAAATAAAGGG + Exonic
1055212155 9:73809348-73809370 TTGTTTAAAAGAAAAATCAAGGG + Intergenic
1056225690 9:84493074-84493096 TTCTGCAAAGGGAAAAACAGAGG + Intergenic
1056226639 9:84501955-84501977 TTTTACAAATGAAAAAGTAAAGG - Intergenic
1056493359 9:87130407-87130429 TTCTGCACATGAAAAAATTAAGG + Intergenic
1057299410 9:93869104-93869126 GTCTGAAAATGAAAACTCATAGG - Intergenic
1057671269 9:97091154-97091176 ATCTGAAAAAGAAAAATCAGAGG - Intergenic
1058050788 9:100404439-100404461 TTATGCAAATGCAAAATAATGGG - Intergenic
1058290450 9:103234762-103234784 ATCTGAAATTGAAAAATAAATGG + Intergenic
1059666880 9:116454931-116454953 TAATGCAAATGAAAAGTTAATGG + Intronic
1059715924 9:116913231-116913253 TTTTGCATATGAGAAACCAAAGG - Intronic
1060482273 9:124023539-124023561 TTCTACAGATGAGAAATCTATGG - Intronic
1061358002 9:130120836-130120858 ATCTGTAACTGAAAAATCAACGG - Intronic
1061429244 9:130520823-130520845 TTCTCCAAATGTAAAACAAAAGG + Intergenic
1062714282 9:137998257-137998279 TTGTGTAATTGAAAAATAAAGGG + Intronic
1185541579 X:906754-906776 CTCTGCAAAGGCAAAGTCAAGGG - Intergenic
1185962056 X:4555183-4555205 TGATGTAAATGAAAAACCAAGGG - Intergenic
1186022304 X:5269979-5270001 TTTTTAAAATGAAAAATGAATGG - Intergenic
1186309699 X:8304154-8304176 TTTTGCAAATGACAGATAAATGG - Intergenic
1186399680 X:9246054-9246076 TTCAGCAAGTGATAAATCATTGG - Intergenic
1186560528 X:10607643-10607665 TTATGCAAATGCAAAGGCAATGG + Intronic
1186564162 X:10644550-10644572 TTTTTCATATGAAAAAGCAAGGG + Intronic
1187107155 X:16255073-16255095 TTCTGCCAATTAGAAAACAAAGG + Intergenic
1187599712 X:20814611-20814633 TTCTGTAAATGAGAAAACACAGG - Intergenic
1187674884 X:21706393-21706415 TCCTGAAAAAGAAAAACCAAAGG + Exonic
1188275591 X:28196707-28196729 TTCTGGAAATGAATAATTTAAGG + Intergenic
1188573759 X:31621050-31621072 ATCTGTAAGTGAAAAATCAGAGG - Intronic
1188776415 X:34225452-34225474 TTCTGAAAATGAAGAAGCAGGGG - Intergenic
1188811013 X:34654928-34654950 CTCTGCAAAGTAAAAATCAAAGG - Intronic
1189732640 X:44037509-44037531 TTCAGCAAATAAACAATCCAGGG - Intergenic
1191059478 X:56279308-56279330 TTATACAATTGAAAAATAAATGG - Intronic
1191933700 X:66403573-66403595 TCCTGAAAATGAAAAATGATGGG - Intergenic
1192601269 X:72466988-72467010 TTTTGCAAATGTAATATGAATGG - Intronic
1192899118 X:75475742-75475764 TTCTGCAAAAAAAAGATCATTGG + Intronic
1193189001 X:78547173-78547195 TTCTGGAAATGCAAAATTATAGG - Intergenic
1194147747 X:90283286-90283308 TACTCCAAAGGAATAATCAAGGG - Intergenic
1194182405 X:90729278-90729300 TTCTACAAATGAGAAAACTAAGG + Intergenic
1194478391 X:94389127-94389149 TTCTGGAAATGAAACCTCACAGG + Intergenic
1194829407 X:98602466-98602488 TTTTACAACTGAAAAAACAAGGG - Intergenic
1194946324 X:100072767-100072789 TTCTCCAAAGGAAAAAGCATAGG - Intergenic
1195165634 X:102216884-102216906 TTTTTTAAATGAAAAATAAATGG + Intronic
1195193224 X:102470207-102470229 TTTTTTAAATGAAAAATAAATGG - Intronic
1195277382 X:103295042-103295064 TTCTGCAAAAAAAAAAAAAAAGG + Intergenic
1195369336 X:104157510-104157532 TTCTACAGATGAAAAAGCCAAGG - Intergenic
1196046961 X:111266647-111266669 TTCTGCAGATACAAAATGAAGGG - Intronic
1196076650 X:111585376-111585398 TTTTGCAAATGAGAAAGCTAAGG - Intergenic
1196769109 X:119275496-119275518 TTGTGCAAATGAAAAAATAGTGG - Intergenic
1197156534 X:123276024-123276046 TTCTCCATATGAAAAGACAAAGG + Intronic
1197215649 X:123864057-123864079 TCCTGAAAATGAAAAAAAAAAGG - Intronic
1197425536 X:126293029-126293051 TTCTTCAAAAAAAAAATGAAAGG + Intergenic
1197607664 X:128604284-128604306 TTCATCAAAAGAAACATCAAAGG + Intergenic
1197794245 X:130283303-130283325 CTCTCAAATTGAAAAATCAAAGG - Intergenic
1198091441 X:133334764-133334786 CTCTGAAAATGACAAATTAAAGG + Intronic
1198970994 X:142279770-142279792 TTCTGTAAATGAAAATACATAGG + Intergenic
1199158394 X:144577369-144577391 TTCTGAAAAATAAAAATAAATGG - Intergenic
1199294258 X:146139287-146139309 TTCTACAGATGAAGAAACAAAGG - Intergenic
1199395163 X:147328407-147328429 TTCTACAACTGAAAAACCTATGG + Intergenic
1199749542 X:150801872-150801894 TTCAGCAAATTAGAAATAAAGGG + Intronic
1200494136 Y:3860045-3860067 TACTCCAAAGGAACAATCAAGGG - Intergenic
1200529024 Y:4311236-4311258 TTCTACAAATGAGAAAACTAAGG + Intergenic
1200756297 Y:6992935-6992957 TTCTGTTTATGAAAACTCAAAGG + Intronic
1201057734 Y:10012295-10012317 TTAAACAAATAAAAAATCAAAGG - Intergenic
1201238283 Y:11932332-11932354 TTCTGGAGATGGAAAACCAAGGG - Intergenic
1202334710 Y:23795570-23795592 TTCTGCAAAGCCATAATCAAAGG + Intergenic
1202536057 Y:25874489-25874511 TTCTGCAAAGCCATAATCAAAGG - Intergenic