ID: 1044425714

View in Genome Browser
Species Human (GRCh38)
Location 8:92047397-92047419
Sequence ATGGAAAATCAGGATAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 463}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044425714 Original CRISPR ATGGAAAATCAGGATAAGGA GGG (reversed) Intronic
901190375 1:7406423-7406445 ATGAACAATCGGGATAGGGAAGG + Intronic
901244120 1:7715194-7715216 AAGGAAAATCAGGAAAAGGGGGG + Intronic
901889720 1:12252422-12252444 ATGGAACCTGAGGATATGGAAGG - Intronic
902159142 1:14515546-14515568 ATGGTAGAACAGGAGAAGGATGG - Intergenic
902346572 1:15822542-15822564 ATGGAATATCAGGATTTCGAGGG - Intergenic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
902827572 1:18987524-18987546 ATGGAAAATTAGGACAAGAAAGG - Intergenic
905821681 1:40997514-40997536 ATTGGAAATCAAGGTAAGGAGGG + Exonic
906372183 1:45263561-45263583 ATGGAGCATGAGGAAAAGGATGG - Intronic
906567818 1:46813308-46813330 CTGGAATATCAGGATAGGGTGGG - Intronic
906636825 1:47415866-47415888 ATGGAAGGCCAGGAGAAGGATGG + Intergenic
907229948 1:52987600-52987622 ATGGAAAAACAGGAGAAAAAAGG - Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907887622 1:58607679-58607701 TTGGATAATCAGGACAAGAACGG - Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908826792 1:68141044-68141066 ATGTAAAATCAGGAAAAACAGGG - Intronic
910015803 1:82521721-82521743 ATGCAAAATCAAGAAAAGGGAGG + Intergenic
910928836 1:92422617-92422639 ATGGAATATGAGGATTGGGAGGG - Intergenic
911031741 1:93496243-93496265 AAGGAAAAAGAGGAGAAGGAAGG - Intronic
911561272 1:99408897-99408919 TTGGAAAAAAAGGAAAAGGATGG - Intergenic
911854247 1:102856605-102856627 ATGGAAAATAAAGAAAAGGAGGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912214210 1:107589114-107589136 AAGAAAAATTAGAATAAGGATGG + Intronic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912481671 1:109986063-109986085 ATGGAAAATCAAGATGTGGTTGG - Intronic
912626064 1:111205059-111205081 ATTGAAATTCAGGATTAGAAGGG - Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913663090 1:121021765-121021787 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
914014473 1:143805030-143805052 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
914163348 1:145156171-145156193 GTGGAAAAGCAGGAAAAGCAGGG - Intergenic
914653097 1:149713587-149713609 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
914833312 1:151186919-151186941 AGGGAAAATAAGGAGATGGAGGG - Intronic
915062290 1:153196023-153196045 ATTTAAAAAGAGGATAAGGAAGG - Intergenic
915147483 1:153803615-153803637 ATGGCAGAGCTGGATAAGGAGGG - Intergenic
915874118 1:159594328-159594350 AAGGAAAATAAGGGAAAGGAAGG + Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
920442490 1:205990219-205990241 CTTGAAAATGAGGATTAGGAGGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922233070 1:223702882-223702904 AAGAAAAACCAGGAGAAGGAGGG + Intronic
922317813 1:224458088-224458110 ATGCAAAATCAGGAGAGGGTAGG - Intronic
924204040 1:241692793-241692815 ATGGGAAATAAGCATAAGAAAGG + Intronic
1063235598 10:4112322-4112344 ATGGAAAATGAGGATAAGAAGGG + Intergenic
1063584190 10:7336491-7336513 ATGAGATATCAGGATAAGGCTGG + Intronic
1064133977 10:12734741-12734763 AAGAAAAATCGGGCTAAGGAGGG - Intronic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064672907 10:17734069-17734091 ATGGAAATCCAGCAAAAGGACGG + Intergenic
1064725071 10:18270755-18270777 AGGGATAATTAGGATAAGGTAGG - Intronic
1064782843 10:18861615-18861637 AATGAAAATGAGGAGAAGGATGG + Intergenic
1065492723 10:26298130-26298152 TTAGTAAATCAGGGTAAGGAGGG + Intronic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1068919733 10:62470478-62470500 ATGCATACACAGGATAAGGAGGG + Intronic
1070364914 10:75727175-75727197 AAGAAAAATCAGGTGAAGGATGG - Intronic
1070620451 10:78005692-78005714 GTGGAAAGTCTGTATAAGGAAGG + Intronic
1070997734 10:80800743-80800765 ATGGATGACCAGCATAAGGAGGG - Intergenic
1071066024 10:81637185-81637207 ATGTAACATCAGGAAATGGAGGG + Intergenic
1071160213 10:82736650-82736672 ATGGAAAATCAGTTTAAGATGGG + Intronic
1071870236 10:89786217-89786239 AGGGAAGATCAAGATTAGGAAGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1074074401 10:110109389-110109411 AGAGAAAATAAGCATAAGGAAGG - Intronic
1074089078 10:110230036-110230058 ATAGAAGTTCAGGAGAAGGAGGG - Intronic
1075313026 10:121430558-121430580 ATGGAAAGTAAAGATAGGGAGGG - Intergenic
1075650182 10:124122784-124122806 ATGGAAAATCACAACTAGGATGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1077848837 11:6054689-6054711 ATGGAAAAGCAAGCAAAGGAAGG - Intergenic
1077876455 11:6312371-6312393 CTAGAAAATCAAGATAAGTATGG + Intergenic
1078656424 11:13244876-13244898 CTGCAAAATCAGGGTAATGATGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078769709 11:14337675-14337697 TTGGAAAAACAGGATATGTAGGG + Intronic
1079290851 11:19186459-19186481 CTGGAAAATGGGGATAATGATGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079763844 11:24364822-24364844 ATGGAAATTAAATATAAGGAAGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1079994374 11:27280156-27280178 ATGAAAAACTAGGATAATGATGG + Intergenic
1080248630 11:30208329-30208351 AAGGAAAATGAAGAAAAGGAAGG + Intergenic
1081385945 11:42473358-42473380 GTGTAGAATTAGGATAAGGAGGG + Intergenic
1083248396 11:61448333-61448355 AGACAAAATCAGGATAAGAAGGG - Intronic
1084458729 11:69284531-69284553 CTGGAAAATTGGGATAATGATGG + Intergenic
1084581171 11:70024372-70024394 AAGGAAAACCAGGACAAGAACGG + Intergenic
1085457225 11:76671911-76671933 GTGGCAAATCAGGGTAAGGCTGG + Intergenic
1085816117 11:79739053-79739075 ATGAAAAATGAGGATACAGAAGG - Intergenic
1086045741 11:82529232-82529254 ATCAAAAATCAGAATAAGGGAGG - Intergenic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086260212 11:84930915-84930937 GTGGAAAATGAGGAAATGGATGG - Intronic
1086507862 11:87524711-87524733 GTGGAAAAACAGGTTATGGAAGG - Intergenic
1087414706 11:97839306-97839328 ATGGAAGAAAAGGAAAAGGAGGG + Intergenic
1088080335 11:105904171-105904193 ATGCATAATCAGGATAAGCTAGG + Intronic
1089450332 11:118590471-118590493 GTGGAAAATGAAGATAAGAAAGG + Exonic
1090373186 11:126271014-126271036 ATGGATATCCAGGATAAGCATGG + Intronic
1091629116 12:2145919-2145941 ATGGAAACTGAGGCTCAGGAGGG - Intronic
1092832989 12:12463292-12463314 ATGGACTATCTGGAAAAGGATGG - Intronic
1092922001 12:13240572-13240594 AAGGAAAATCAGGAGACTGAAGG - Intergenic
1093725909 12:22508339-22508361 AGGGAAAATAAGGAAGAGGATGG + Intronic
1094020693 12:25910890-25910912 ATGGAAAATAAGCAGTAGGAAGG - Intergenic
1094816668 12:34193375-34193397 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1095445789 12:42280810-42280832 ATAGAAAAGTAGGATAAGAAAGG - Intronic
1095688161 12:45059466-45059488 ATGGAATATCAGGTTCATGAAGG - Intergenic
1097313127 12:58143037-58143059 CTGTAAAATGAGGATAATGATGG - Intergenic
1097575142 12:61383355-61383377 TTGGAAATTCTGGAGAAGGAAGG + Intergenic
1097859337 12:64503020-64503042 ATGGAAAATTAAAATAAAGAGGG - Intergenic
1097981780 12:65742645-65742667 AAGGGAAATCCGGATAAGGATGG + Intergenic
1098112461 12:67137612-67137634 ATGTAAAACTAGGATAAGGTGGG + Intergenic
1098627377 12:72689063-72689085 ATTGAAAATTAGGATAAGGGTGG + Intergenic
1099144165 12:79017982-79018004 ATGGATAATGAGGACAAAGAAGG + Intronic
1099303154 12:80922670-80922692 ATCGAAACTGAGGATAAGGGGGG - Intronic
1099913929 12:88868169-88868191 ATGGAAAATAAGGATTAAGATGG + Intergenic
1100017608 12:90030186-90030208 AAGGAAACTGAGGAAAAGGAGGG + Intergenic
1100090359 12:90961051-90961073 CTGGAAAATCAGCAAAAAGATGG - Intergenic
1101945047 12:109130274-109130296 CTGCAAAATGGGGATAAGGATGG - Intronic
1101970191 12:109307443-109307465 AGGGAAAAGGAGGAAAAGGAAGG - Intronic
1103946939 12:124532090-124532112 CTGGAGAATGGGGATAAGGACGG + Intronic
1106972702 13:35162429-35162451 AAGGAAAATGAGGAGAAGCATGG - Intronic
1107618999 13:42205437-42205459 ATGGAAAAAAAGGATATGGCTGG - Intronic
1111226661 13:85282550-85282572 ATGGAATATCTGGACAAGGGTGG + Intergenic
1111439403 13:88260056-88260078 ATGGAAAACAAGGATATGAAAGG + Intergenic
1111536862 13:89612632-89612654 AGGGAAAATAAGGAGAAGGTAGG - Intergenic
1112523096 13:100115959-100115981 AAGTAAAAGCAGGATAATGATGG + Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113717688 13:112524747-112524769 ATGGTAACTCAGGACAAGGCAGG - Intronic
1114166354 14:20222671-20222693 ATGGAAAAGCAAGATAATGAAGG + Intergenic
1114266891 14:21077966-21077988 CTGTAAAGTCAGGATAAGAAAGG - Intronic
1114642834 14:24235844-24235866 CTGGAAAACTGGGATAAGGAAGG - Intronic
1115282072 14:31675203-31675225 ATAGAATATCAGGATAAAGATGG + Intronic
1116642991 14:47488569-47488591 ATGAAAAATGAGCATAAGCAAGG + Intronic
1117806089 14:59492355-59492377 ATGGAAAATCAGGTGCAAGAAGG + Intronic
1117946723 14:61033996-61034018 CTGTAAAATCAGCAAAAGGAAGG - Intronic
1118323405 14:64766347-64766369 TTGGAAAATGGGGAAAAGGACGG + Intronic
1119186176 14:72644042-72644064 ATGGAAAATGAGGATGATGATGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119498470 14:75101813-75101835 AAGGAAAATCAGGCTGAGAATGG + Intronic
1120351163 14:83360178-83360200 ATGTAAAAACAGTATAAAGATGG - Intergenic
1121854530 14:97254926-97254948 ATGGAAAATCTGGAGAGAGAAGG - Intergenic
1122001576 14:98661061-98661083 ATGTAAAATAAGAATAAGCAAGG + Intergenic
1122794427 14:104198906-104198928 GTGAAAAATGAGGCTAAGGAAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125599799 15:40909163-40909185 ATGGAAAATGAGTATAAAGAAGG - Intergenic
1125763687 15:42118177-42118199 TTAGAACATCAAGATAAGGAAGG + Intergenic
1126430629 15:48580112-48580134 TTGGAAAAACTGGACAAGGAAGG - Intronic
1127526110 15:59792844-59792866 ATGGAAAATGAGGATAGAAAAGG + Intergenic
1128649672 15:69401293-69401315 ATGGAAAATCAGGAACAAAATGG - Intronic
1129482325 15:75837477-75837499 TGGGAAATTCAGGAAAAGGAGGG + Intergenic
1129505962 15:76081648-76081670 ATGGACACTCAGGTTCAGGAAGG - Intronic
1129588652 15:76894521-76894543 ATCTAAAGTCAGCATAAGGAAGG + Intronic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1131631640 15:94182728-94182750 TTGGAATATCAGGAAAAGAAAGG + Intergenic
1131687276 15:94782014-94782036 ATGGAAAATGAAGGGAAGGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135624878 16:23985772-23985794 GTTGAAAATAAGGATAATGAGGG + Intronic
1136285920 16:29241722-29241744 ATGGAAAAGCATGAAATGGAGGG - Intergenic
1137027039 16:35486640-35486662 CGGGAGATTCAGGATAAGGAGGG - Intergenic
1137514611 16:49132359-49132381 AGGGAATATGAGGATGAGGAAGG + Intergenic
1137729417 16:50679086-50679108 ATGGAAATTCAAGACAAGGAAGG + Intronic
1137928640 16:52565540-52565562 ATGGGAAATCAGTAGAAGGCAGG + Intergenic
1139959191 16:70708083-70708105 ATGGAAAATAAGGCCAAGGCAGG - Intronic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140251367 16:73297209-73297231 ATGGAAACTGAGGTTAAGAAAGG + Intergenic
1141263938 16:82479008-82479030 ATGGAAAATGAGGAAAAGCTGGG + Intergenic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141888774 16:86912155-86912177 TTGGAAAATGAGGATAGTGAGGG - Intergenic
1141932236 16:87213593-87213615 ATGGTAAATGATGATAAGGATGG + Intronic
1142091258 16:88211908-88211930 ATGGAAAAGCATGAAATGGAGGG - Intergenic
1142220686 16:88853554-88853576 TTGGAAAATAGGGTTAAGGAGGG - Intronic
1142424249 16:89992567-89992589 ATAATAAGTCAGGATAAGGAGGG + Intergenic
1143095631 17:4476975-4476997 AAGGACAGTCAGGATCAGGACGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143635127 17:8160012-8160034 TTGGAAAATGAGGGTAAGGGAGG + Exonic
1143669961 17:8389795-8389817 ATGGAAAATGAGGAAAAGCAAGG - Intergenic
1143972331 17:10804622-10804644 ATGGACAGTAAGGATAAGGGCGG + Intergenic
1146096084 17:29931092-29931114 ATGGAAAATCAAGATTAAAAAGG + Intronic
1146155601 17:30521831-30521853 AAGGAAAATGAGGAAAGGGAGGG + Intronic
1148080026 17:44962895-44962917 ATGGATAATTAGGATAATTACGG - Intronic
1148948901 17:51291402-51291424 TTGGAATATCGGGAAAAGGAGGG - Intronic
1149008866 17:51834353-51834375 ATGGGAAAACAGGAAAAGAATGG + Intronic
1149577072 17:57721681-57721703 ATTGAAACTGTGGATAAGGAGGG + Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151118653 17:71767299-71767321 ATAGAAAATCAGTCTAATGAAGG + Intergenic
1152890129 17:82875666-82875688 CTGGAAAATCAGGAAATGGCAGG + Intronic
1153826992 18:8883976-8883998 ATGGAAAGATAGGATAAGGCAGG + Intergenic
1154314107 18:13290252-13290274 ATGGAAAACCAGGGACAGGAAGG - Intronic
1155016298 18:21844116-21844138 CTTGATATTCAGGATAAGGATGG + Exonic
1156054016 18:32975971-32975993 ATGCATAATGAGGATAATGATGG - Intronic
1156759102 18:40565604-40565626 ATGAATAATCAAGAAAAGGAGGG - Intergenic
1156879043 18:42053924-42053946 ATGGCAACTCAAGATCAGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1158494656 18:57943480-57943502 AAGAAAAATGAGGAGAAGGAGGG - Intergenic
1158999366 18:62957560-62957582 ATGTAAAATGAGGAAAAGGCAGG - Intronic
1160355178 18:78221639-78221661 ATGGCAAATCCAGATGAGGAAGG - Intergenic
1161803313 19:6427587-6427609 AAGGAAAATGAGGCTCAGGAAGG + Intronic
1162247621 19:9415572-9415594 ATAGAAAATCAGAATAAAGCTGG - Intronic
1163464509 19:17459335-17459357 ATGGAGAATGAGGAAAGGGAAGG - Intronic
1164706265 19:30322606-30322628 AGGGAAATTCGGGAAAAGGATGG - Intronic
1164980656 19:32611321-32611343 ATGAAAACACAGGATAAGAAAGG - Intronic
1165546786 19:36544538-36544560 ATGGTAACTCAGGATAAAAAGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167608096 19:50492507-50492529 GTGGACAATCAGGAAAAGGTGGG + Intergenic
1168184218 19:54687543-54687565 AAGGAAAGTAAGGATAAGGCTGG - Intronic
1168307658 19:55444058-55444080 CTGTAAAATGGGGATAAGGATGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926177020 2:10602674-10602696 ATGGAAAATCAAGAAAAGAATGG + Intronic
926221869 2:10941704-10941726 AGGGAAACCCAGGAGAAGGATGG + Intergenic
926383908 2:12317299-12317321 AGGGAAAGGCAAGATAAGGATGG + Intergenic
926530092 2:14033469-14033491 ATGGAAAACCAGGAAAGGGAAGG + Intergenic
927369584 2:22339076-22339098 ATGGAAAATAAAGATAAGTGTGG + Intergenic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928687981 2:33768953-33768975 AGGGAAAAGCAGGAGAAGGGTGG + Intergenic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932961634 2:76419233-76419255 AAGAAAAATGAGGAAAAGGAAGG - Intergenic
933024603 2:77239856-77239878 ATAGAAAATCAGTATAATCATGG + Intronic
933436634 2:82257650-82257672 ATGGAGAATAAGGAAAAGCAGGG - Intergenic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
933519637 2:83353551-83353573 ATAGAAAATTAGTAAAAGGATGG - Intergenic
933701423 2:85257871-85257893 ATGGAAAATCAAGAGCCGGAAGG - Intronic
933880170 2:86661664-86661686 CTGGAAAATAAGGATATGGAGGG - Intronic
935366121 2:102292688-102292710 ATGCAAAATAAAGATAATGATGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936592355 2:113816274-113816296 GTGGAACCTGAGGATAAGGAGGG + Intergenic
937887215 2:126908131-126908153 ATGGAAATAGGGGATAAGGATGG + Intergenic
939886959 2:147691505-147691527 ATGTTAAATCATGATTAGGAAGG + Intergenic
940664792 2:156595048-156595070 CTGGAAAATGAGGGTAAAGATGG + Intronic
940684732 2:156832842-156832864 AAGGAAAATCAGTATATGGAAGG + Intergenic
941409482 2:165136198-165136220 ATGGAAACACAGGATAAGAGAGG - Intronic
941650407 2:168086123-168086145 ATGGATGATCAGGATAACGATGG + Intronic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943526407 2:189021964-189021986 TGGGAAAATTAGGTTAAGGAGGG + Intergenic
943795607 2:191989304-191989326 ATGGAAACTCAGACCAAGGATGG + Intronic
944296402 2:198067840-198067862 AATGAAAATCAAAATAAGGAGGG - Intronic
944342485 2:198619078-198619100 GAGGAAAATAAGGATAAGAAAGG - Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945459728 2:210091784-210091806 ATGGAAAATTGGGATGAAGAAGG - Intronic
946349214 2:219137713-219137735 ATGGAAAATAAGAATAAGAATGG - Intronic
946584602 2:221170611-221170633 ACTGAAACTGAGGATAAGGAAGG + Intergenic
946693067 2:222324099-222324121 CTGTAAAATGAGGATAAGGGTGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948491488 2:238315904-238315926 GTGGACAATCAGGAGAAGAATGG + Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169326728 20:4682686-4682708 AAGGTAAATCAGGCTAAGCATGG + Intergenic
1169720940 20:8675630-8675652 ATGGAACTTCAGGATAAATATGG + Intronic
1169948763 20:11018754-11018776 ATGGAATCTGAGGATAGGGAGGG + Intergenic
1170030714 20:11941197-11941219 AGGGAAAATCATGATAAATAAGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172617700 20:36300059-36300081 ATAGAAAATGAGGACAAGGCTGG - Intergenic
1172679273 20:36699757-36699779 AGGGAAGGTCAGGAGAAGGATGG + Intronic
1172763170 20:37336328-37336350 ATGGATAAAGACGATAAGGAAGG + Intergenic
1172856207 20:38004822-38004844 ATGGCAAATCTGGATTATGAGGG + Intronic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173297114 20:41769560-41769582 TTGGAAAATTAGCATAAGGGAGG + Intergenic
1173403584 20:42745744-42745766 ATGGAAAATTAGCATAAGGAGGG + Intronic
1174979422 20:55376337-55376359 ATGTAGAATCAGGAAAAGCAGGG - Intergenic
1175062023 20:56252202-56252224 CTGCAAAATCAGGATAACCATGG - Intergenic
1176979694 21:15366926-15366948 ATAGATAATCAGGAGAAGAAAGG - Intergenic
1177495700 21:21888203-21888225 AACAAAAATCAGGATAAAGAAGG + Intergenic
1177754527 21:25330040-25330062 TTGCAAAATGAGGATAATGAGGG + Intergenic
1178755728 21:35347598-35347620 AGAGAAGATCAGGATAAGGAGGG - Intronic
1180097445 21:45563962-45563984 AATGAAGATAAGGATAAGGATGG + Intergenic
1181913549 22:26260002-26260024 ATGCCAAATCAGGATATGGGAGG - Intronic
950208213 3:11096391-11096413 GTGGGAAAGCAGGATATGGAAGG - Intergenic
951126411 3:18989804-18989826 ATGGAAAATGAGGTTCGGGATGG + Intergenic
951999242 3:28766812-28766834 CTGGAATAACAGGATAAAGAGGG - Intergenic
952141650 3:30485799-30485821 ATGGGTAATCAGTTTAAGGAAGG + Intergenic
952437986 3:33291786-33291808 ATGGAAAATAAATATAAAGATGG + Intronic
952629307 3:35445544-35445566 ATGTAAACTGTGGATAAGGAGGG - Intergenic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
956457129 3:69433413-69433435 GTGTAAAAACAGGACAAGGAGGG + Intronic
957690264 3:83556955-83556977 ATGGAGAATGAGGAAAAGAAGGG - Intergenic
957734007 3:84182389-84182411 ATGTAATATCACGATCAGGATGG + Intergenic
957932946 3:86906055-86906077 TTTGAAAATGAGGATAAGCATGG - Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958069033 3:88585375-88585397 ATGGATAATCATGAAAAAGAAGG + Intergenic
958612695 3:96447730-96447752 ATGGATAATAAGTAGAAGGATGG + Intergenic
959015170 3:101125346-101125368 ATGGAAATTCAACAAAAGGAAGG + Intergenic
959193415 3:103144922-103144944 TTGGAAGATCAGGAGAATGAAGG + Intergenic
959563116 3:107805180-107805202 GGGGAAAAAAAGGATAAGGAAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960885512 3:122390206-122390228 GTGGAAAATAAGGATAAGTTTGG + Intronic
961609977 3:128128945-128128967 ATGGAAATACAAGAAAAGGAAGG - Intronic
961856050 3:129872594-129872616 ATTCAAAAACAGGATATGGAGGG - Intronic
962497201 3:135952932-135952954 GTGGAAAATGAGTTTAAGGAGGG + Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963493693 3:146033521-146033543 AAGGAAAATAAGGAAAAGGAAGG + Intergenic
964166522 3:153713228-153713250 AGGGAATATCAGGATAATGAAGG - Intergenic
964212507 3:154244253-154244275 ATGTAAAATCAGCAGTAGGAGGG + Intronic
964321049 3:155497614-155497636 AGGGAAAGTGAGGATAAGGGGGG - Intronic
965373054 3:167888870-167888892 ATTAAAAAGCAGGCTAAGGAAGG - Intergenic
966005661 3:175008475-175008497 AAGGAAACGGAGGATAAGGAGGG + Intronic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
970704110 4:18779400-18779422 ATGGAAACCATGGATAAGGAGGG + Intergenic
971084674 4:23258563-23258585 TTGGAAGATGAGGGTAAGGAGGG + Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971251325 4:24975512-24975534 AAGGAAAAGTAGGATAGGGAAGG + Intronic
972022142 4:34328340-34328362 ACGGAAAATTAGTACAAGGAAGG + Intergenic
974148354 4:57973710-57973732 AGGAAACATCAGGATAAGAATGG + Intergenic
974241035 4:59247467-59247489 AAGGAAAATAGGGAAAAGGAAGG - Intergenic
975938713 4:79614148-79614170 ATGTAGAATTAAGATAAGGATGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
976049241 4:80991667-80991689 ATGGAAACTGAGGCTAAGGGAGG + Intergenic
976152516 4:82106392-82106414 ATGGTAACTCAGTAGAAGGAAGG + Intergenic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
978014074 4:103722305-103722327 AAGGAAAAAAAGGATAATGATGG + Intergenic
978165585 4:105602913-105602935 ACAGACAATAAGGATAAGGAAGG - Intronic
978181783 4:105806635-105806657 TTGGAAAATCTGTATACGGATGG - Intronic
978292422 4:107158607-107158629 ATGGAAAATCTAGAGAATGATGG - Intronic
978459251 4:108931883-108931905 ATGGACAATCAGATTAAGGGAGG + Intronic
978698248 4:111609585-111609607 ATGGAAACTGAGGCTAAGAAAGG - Intergenic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
980289249 4:130824545-130824567 AAGGAAAATGAGTATTAGGATGG + Intergenic
980794609 4:137664876-137664898 ATGAAATATCAGGATAAAGCAGG - Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981530965 4:145753431-145753453 ATGGAAGATTGGGATAAAGATGG - Intronic
982090458 4:151875938-151875960 ATGGAAAATGAAGAGAAGGCCGG + Intergenic
982445760 4:155489161-155489183 AGGGAAAATGAGAACAAGGAAGG - Intergenic
982469228 4:155767000-155767022 TTGCAAAATGAGGATAATGAAGG - Intronic
983961383 4:173759350-173759372 ATGGAAACTAAGGCTCAGGAAGG - Intergenic
984255276 4:177382608-177382630 ATTGAAAGTGAGGATATGGAAGG - Intergenic
984612005 4:181851518-181851540 TTGGAATACCAGGAAAAGGAGGG - Intergenic
984936845 4:184897377-184897399 CTGGAAACTCGGGATAAGAATGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986901179 5:12435738-12435760 ATGAAAAAAGAGGAAAAGGAAGG - Intergenic
986955522 5:13145713-13145735 ATGGAAAATAAAGATTAGTAAGG + Intergenic
986966632 5:13280617-13280639 AGGGATACTCAGGATAATGATGG + Intergenic
987018239 5:13843201-13843223 TTGCAAAATCAGGATAAAAAAGG - Intronic
987689395 5:21247023-21247045 ATGTAAAATCAGAATATGTATGG - Intergenic
987743340 5:21937963-21937985 ATGGAAGGTCAGGAAAAGGCTGG - Intronic
987886141 5:23815522-23815544 AAGGAAAATAAGGAAAAGAAAGG - Intergenic
988578121 5:32445516-32445538 AAGGAAAATAAGGGTAAGGGAGG + Intergenic
989469954 5:41804524-41804546 ATGGTAAGTCAGGATAAGACGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989624671 5:43417853-43417875 TTGGAAAATTAGTATATGGATGG + Intergenic
989625207 5:43423230-43423252 ATAGAAAAACAGGCTATGGATGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990762900 5:59150153-59150175 GAGGAATATGAGGATAAGGATGG + Intronic
991603113 5:68373133-68373155 ATGGGAAAACTTGATAAGGAAGG + Intergenic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991749570 5:69786544-69786566 ATGGAAGGTCAGGAAAAGGCTGG + Intergenic
991763540 5:69948096-69948118 ATGGAAGTTCAGGAAAAGGCTGG - Intergenic
991783786 5:70170033-70170055 ATGGAAGGTCAGGAAAAGGCTGG + Intergenic
991801149 5:70366358-70366380 ATGGAAGGTCAGGAAAAGGCTGG + Intergenic
991827450 5:70643684-70643706 ATGGAAGGTCAGGAAAAGGCTGG - Intergenic
991842769 5:70823156-70823178 ATGGAAGGTCAGGAAAAGGCTGG - Intergenic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
991876232 5:71170408-71170430 ATGGAAGGTCAGGAAAAGGCTGG + Intergenic
991953434 5:71969459-71969481 ATGTAAAAGCAAGATTAGGAAGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993399361 5:87429813-87429835 ATGTAAACTAAAGATAAGGAGGG - Intergenic
994133578 5:96260018-96260040 ATGGAAAAAAAAGAAAAGGATGG - Intergenic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994180900 5:96765031-96765053 ATGGAAGATCAGGAGAAGAGCGG - Intronic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995558106 5:113351505-113351527 ATGGAGATAGAGGATAAGGATGG + Intronic
996292872 5:121874768-121874790 ATGGAAAATTAGTATCAGGTAGG - Intergenic
996417289 5:123223833-123223855 ATGAAAAATCAGCAGAAAGAAGG + Intergenic
997780745 5:136655666-136655688 ATGAAAAAGCAGGATAAAGGTGG - Intergenic
998699738 5:144684272-144684294 AGGGAAAGTCAAGATAGGGATGG + Intergenic
1001487512 5:172130063-172130085 ATGGAACTTCAGGATGTGGAAGG - Intronic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1001897571 5:175394525-175394547 ATGAACAAAGAGGATAAGGAAGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004014005 6:11715961-11715983 ATGGAAAATAAGGCCAAGGGTGG - Intronic
1004412778 6:15396777-15396799 ATCTAAAATCCGGATAAGGAGGG + Intronic
1004553552 6:16673423-16673445 TGGGAAGAGCAGGATAAGGAAGG - Intronic
1005417084 6:25611492-25611514 ATGGAAAATTAGGGTAGGAATGG - Intronic
1005792391 6:29317589-29317611 ATGAAAAATCAGGCTACAGAAGG - Intergenic
1005808369 6:29496278-29496300 AAGGAAATTCAGCATAAGCAAGG + Intergenic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1005939512 6:30550392-30550414 AAGGAAAGTGAGGATAAAGAAGG - Intronic
1006766999 6:36515213-36515235 AAGGAAAATCATGACAAGGCAGG + Intronic
1007095971 6:39213443-39213465 ATACAAAATCAAGATGAGGAGGG - Intronic
1008003170 6:46382033-46382055 ATTGGAAATCATGAAAAGGAAGG - Intronic
1008240491 6:49104072-49104094 ATGGAATAACAACATAAGGAAGG + Intergenic
1008979736 6:57469190-57469212 AGGGAAACTCAGGCTCAGGATGG - Intronic
1010022538 6:71177468-71177490 ATAAAACATCAGGATGAGGATGG + Intergenic
1011228664 6:85135705-85135727 GGGGAAGATGAGGATAAGGAAGG + Intergenic
1011381017 6:86742263-86742285 ATGCAAAATCATGATCAGGATGG - Intergenic
1011485328 6:87834873-87834895 GGTGAAAATCAGCATAAGGAAGG + Intergenic
1011705245 6:89994719-89994741 AAGGAAGATCAGGAAAAGGATGG - Intronic
1012098552 6:94998883-94998905 ATGGAAAATCATGAGTTGGAAGG + Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012744759 6:103071757-103071779 AAGGAAAATCAGTATATTGAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013309261 6:108878562-108878584 ATGGAATATCTGAATATGGATGG + Intronic
1013473054 6:110482604-110482626 ATGGTAATGCAGGAAAAGGATGG - Intergenic
1013520567 6:110929280-110929302 AATGAAAATAATGATAAGGATGG - Intergenic
1013986932 6:116205670-116205692 ATACAAAATCAGAATAAAGACGG - Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017281090 6:152626814-152626836 ATAGAAAATCAGGATATTGGTGG - Intronic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017599151 6:156061892-156061914 TTGTAAAATCAGGTGAAGGAAGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018880287 6:167871535-167871557 ATGAAAAATAAGGAAAAGAATGG - Intronic
1020714892 7:11660282-11660304 TTGGAAAATTAGGTTAAGTAAGG + Intronic
1020951208 7:14680068-14680090 ATAGAAAATAAGGCTGAGGATGG + Intronic
1023206945 7:37761420-37761442 ATAGAAATTGAGGATAAGAAAGG + Intronic
1024570705 7:50721152-50721174 AAGTAAAACCAGGATAAGGGGGG - Intronic
1025121372 7:56306841-56306863 GTGGAAAAAAGGGATAAGGAAGG + Intergenic
1027664108 7:81022884-81022906 ATGGAAATTCAGGATGATAAGGG + Intergenic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1027962441 7:84963751-84963773 ATAGAAAATGAAGAGAAGGAAGG + Intergenic
1028114087 7:86977913-86977935 TTAGAAAATATGGATAAGGATGG + Intronic
1029091257 7:98050035-98050057 TTGGAAAATCAGGGTAAAAATGG - Intergenic
1031211203 7:118828819-118828841 CTGGAAGGTCATGATAAGGAAGG + Intergenic
1031659257 7:124399840-124399862 ATGGGAAATCAGGCTATGGAGGG + Intergenic
1031781133 7:125967069-125967091 AGGGAAAATCTGGATAACTAAGG - Intergenic
1032442793 7:131954982-131955004 CTGAAACATCAAGATAAGGAAGG - Intergenic
1032593425 7:133214805-133214827 ATGGAACGTCAGGTTAAAGATGG - Intergenic
1033493540 7:141869863-141869885 AAGAAAAATCAAGATAAGGCTGG + Intergenic
1034121665 7:148633514-148633536 AGAGATAATGAGGATAAGGAAGG + Intergenic
1034435764 7:151062164-151062186 ATGCAAAGTCAGGGTAGGGATGG - Intronic
1035646370 8:1224251-1224273 AGGGAATATCAGGATGAGTAAGG + Intergenic
1035688755 8:1546453-1546475 ATGGAAACATGGGATAAGGAAGG - Intronic
1036610442 8:10345284-10345306 ATGGAAACTGAGGCTAAGGTGGG - Intronic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038902487 8:31859333-31859355 ATGGAAAAACAAGATTATGATGG - Intronic
1038992093 8:32878950-32878972 ATGGAAATACAGGAAAAGGGTGG - Intergenic
1040718388 8:50287132-50287154 AAAGAAAGCCAGGATAAGGATGG - Intronic
1041214945 8:55591138-55591160 ATGGCAAATCAGGCCAAGCACGG - Intergenic
1041737960 8:61131785-61131807 ATGGAAGATGAGGAGAATGAAGG + Intronic
1042001576 8:64128293-64128315 ATGGAAAATAAGCATAGGAAAGG + Intergenic
1042567717 8:70129422-70129444 CTACAAAATCAGGATAATGATGG - Intronic
1042729380 8:71914732-71914754 ATAGAAGATCAGTATAAGGAGGG - Intronic
1044021371 8:87109957-87109979 TTGGAATATCAGGAAAAAGAAGG - Intronic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1046078660 8:109343053-109343075 ATGAAAAATCACCATAAGCAAGG - Intronic
1047059376 8:121206991-121207013 ATGGAAACTGAGGCTTAGGAGGG + Intergenic
1047336918 8:123944886-123944908 ATGTAAAACAAGGAGAAGGATGG - Intronic
1047505379 8:125475537-125475559 ATGGAAAATTCTGAAAAGGAAGG + Intergenic
1048014338 8:130484050-130484072 AGGGAAAGTCAGGAGAAGGGAGG - Intergenic
1048026211 8:130589319-130589341 ATGGAGAATGAGGAGATGGAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048260418 8:132940314-132940336 ATGGAAAATGGGCATAAGAATGG + Intronic
1048302595 8:133262501-133262523 ATGGAAAGAGAGGATCAGGAGGG - Intronic
1048773870 8:137923883-137923905 ATGGACAATGAATATAAGGATGG - Intergenic
1048777765 8:137966559-137966581 CTGGAAACTGAGGACAAGGAGGG - Intergenic
1048920145 8:139221757-139221779 ATGGAAAATAAGCATATGAAAGG + Intergenic
1049263711 8:141653659-141653681 ATGCAAAACCAGGAACAGGAGGG + Intergenic
1049930929 9:455721-455743 GTGGTAAATGATGATAAGGATGG - Intronic
1050469223 9:5968372-5968394 ATAGAAAATCAGGAAAAATACGG - Exonic
1051152169 9:14094027-14094049 CTGTAAAATCAGGATAATAATGG - Intronic
1051379172 9:16437391-16437413 ATGGCAATTCAGGAGAAAGAAGG - Exonic
1052950287 9:34203787-34203809 AAGGAAAAACAATATAAGGATGG - Intronic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054343871 9:63895086-63895108 CTGAAAAGTCAGGAAAAGGAGGG - Intergenic
1055164953 9:73179925-73179947 ACGTAAAATCAGGATATTGATGG + Intergenic
1055924673 9:81497418-81497440 AGGGTAAATCAAGATAAGGTTGG - Intergenic
1056072288 9:83000110-83000132 AGAGAAAATCAAGCTAAGGAAGG + Intronic
1056608109 9:88104114-88104136 ATGGAAACTGATGAGAAGGATGG + Intergenic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1057188029 9:93069383-93069405 AGTGAAAACAAGGATAAGGACGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058771890 9:108242122-108242144 AGGGAACATGAGGAGAAGGAGGG - Intergenic
1059648452 9:116291244-116291266 ATGGAATATCTGGATAGGAAAGG - Intronic
1060730946 9:126036745-126036767 CTGGAAAATGGGGATATGGATGG - Intergenic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1186205528 X:7196232-7196254 ATGGTAAACCAGGGTAAGGTTGG + Intergenic
1186427818 X:9478078-9478100 CTGTAAAATCAGGATAACCATGG + Intronic
1186437738 X:9557508-9557530 ATGGAATACCAGGAGAGGGATGG + Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187977695 X:24719779-24719801 AAGGAAAGTGAGGAAAAGGAGGG - Intronic
1188775060 X:34206657-34206679 GGGGAAAATCAGGAAAAGAAGGG - Intergenic
1188946980 X:36317210-36317232 ATAGCCAATCAGGATAAGCATGG + Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1191034296 X:56008371-56008393 ATGGAGAATAAGGAAAAGCAGGG + Intergenic
1191999273 X:67130835-67130857 TTGTAAAATGGGGATAAGGATGG + Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1193164433 X:78264624-78264646 ATGGAGAATGAGGAAAAGCAGGG - Intergenic
1193291603 X:79779580-79779602 AAGGAAAAGGAGGAAAAGGAGGG - Intergenic
1193801122 X:85937544-85937566 ATGGAAAATCAGGCTGGGCATGG + Intronic
1194072760 X:89348262-89348284 ATAAAAATTCAGAATAAGGAGGG - Intergenic
1195377703 X:104243925-104243947 AGGGAAAACCAGGATAGAGAGGG - Intergenic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196164083 X:112519271-112519293 GTGGAAAGTCAGGATGAAGAGGG - Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1196537892 X:116868585-116868607 ATGGAAAATGAAGAAAAGCAGGG - Intergenic
1197902747 X:131391763-131391785 TTGGAAAATATGGAGAAGGAAGG - Intronic
1198495721 X:137190916-137190938 ATGGAAAATAAGCAAAAGTAGGG + Intergenic
1199168419 X:144705543-144705565 AGAGAAAGTCAGAATAAGGAAGG - Intergenic
1199512477 X:148638068-148638090 ATGGAAAACAAGGATATGGCAGG - Intronic
1199828426 X:151523933-151523955 ATGATAAATCAGGCTAAGAAAGG + Intergenic
1199900813 X:152170180-152170202 ATGGGAAATCAGTCAAAGGAGGG + Intronic
1200749670 Y:6933389-6933411 CTGTAAAATCAGGATAATGATGG + Intronic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201761582 Y:17545266-17545288 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1201839970 Y:18360724-18360746 ATGGAGAATGAGGAGAAAGAAGG - Intergenic
1201943520 Y:19484424-19484446 TTGGAAAATCAAGGGAAGGATGG + Intergenic