ID: 1044428791

View in Genome Browser
Species Human (GRCh38)
Location 8:92084669-92084691
Sequence ATTCTATCTTTGGGGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044428783_1044428791 28 Left 1044428783 8:92084618-92084640 CCAGCAGAGAAGTCTGAATTGCA 0: 1
1: 0
2: 2
3: 18
4: 285
Right 1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044428791 Original CRISPR ATTCTATCTTTGGGGAGGAA GGG Intronic
No off target data available for this crispr