ID: 1044433201

View in Genome Browser
Species Human (GRCh38)
Location 8:92133102-92133124
Sequence ATGTCTTTCTAGCTGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044433201_1044433202 14 Left 1044433201 8:92133102-92133124 CCTTAACACAGCTAGAAAGACAT No data
Right 1044433202 8:92133139-92133161 TATATTTGCCCCATTTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044433201 Original CRISPR ATGTCTTTCTAGCTGTGTTA AGG (reversed) Intergenic
No off target data available for this crispr