ID: 1044436341

View in Genome Browser
Species Human (GRCh38)
Location 8:92168238-92168260
Sequence GAAATTGTACACATGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044436341_1044436343 18 Left 1044436341 8:92168238-92168260 CCTAGATGCATGTGTACAATTTC No data
Right 1044436343 8:92168279-92168301 TTATGTTTGCACATTGAGGCAGG No data
1044436341_1044436342 14 Left 1044436341 8:92168238-92168260 CCTAGATGCATGTGTACAATTTC No data
Right 1044436342 8:92168275-92168297 AGAATTATGTTTGCACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044436341 Original CRISPR GAAATTGTACACATGCATCT AGG (reversed) Intergenic
No off target data available for this crispr