ID: 1044444786

View in Genome Browser
Species Human (GRCh38)
Location 8:92263049-92263071
Sequence AAATTAACACTAATTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044444786_1044444787 -5 Left 1044444786 8:92263049-92263071 CCATAAGGAATTAGTGTTAATTT No data
Right 1044444787 8:92263067-92263089 AATTTTTAAGTTGTAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044444786 Original CRISPR AAATTAACACTAATTCCTTA TGG (reversed) Intergenic