ID: 1044444807

View in Genome Browser
Species Human (GRCh38)
Location 8:92263372-92263394
Sequence TGTCTACTGATTATATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044444807_1044444811 19 Left 1044444807 8:92263372-92263394 CCACCCAATATAATCAGTAGACA No data
Right 1044444811 8:92263414-92263436 TACACTCAAACTTACTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044444807 Original CRISPR TGTCTACTGATTATATTGGG TGG (reversed) Intergenic
No off target data available for this crispr