ID: 1044455480

View in Genome Browser
Species Human (GRCh38)
Location 8:92388004-92388026
Sequence AGACCTCAGTCTACAACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044455480_1044455482 15 Left 1044455480 8:92388004-92388026 CCACTTGTTGTAGACTGAGGTCT No data
Right 1044455482 8:92388042-92388064 TACTTATTAGTTTTGTGACCTGG No data
1044455480_1044455483 16 Left 1044455480 8:92388004-92388026 CCACTTGTTGTAGACTGAGGTCT No data
Right 1044455483 8:92388043-92388065 ACTTATTAGTTTTGTGACCTGGG 0: 2
1: 20
2: 152
3: 874
4: 3348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044455480 Original CRISPR AGACCTCAGTCTACAACAAG TGG (reversed) Intergenic
No off target data available for this crispr