ID: 1044464121

View in Genome Browser
Species Human (GRCh38)
Location 8:92483915-92483937
Sequence CACCTAGGTGTGGCCTCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044464116_1044464121 4 Left 1044464116 8:92483888-92483910 CCAGACTGCATTTCCTAGCTTCC No data
Right 1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG No data
1044464118_1044464121 -9 Left 1044464118 8:92483901-92483923 CCTAGCTTCCTTTGCACCTAGGT No data
Right 1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG No data
1044464115_1044464121 17 Left 1044464115 8:92483875-92483897 CCTAGACTCACAGCCAGACTGCA No data
Right 1044464121 8:92483915-92483937 CACCTAGGTGTGGCCTCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044464121 Original CRISPR CACCTAGGTGTGGCCTCGTG AGG Intergenic
No off target data available for this crispr