ID: 1044468316

View in Genome Browser
Species Human (GRCh38)
Location 8:92534356-92534378
Sequence TCCAAGGCTTTGGGGGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044468309_1044468316 14 Left 1044468309 8:92534319-92534341 CCTATCTCAAGCACTGGCTTTCT No data
Right 1044468316 8:92534356-92534378 TCCAAGGCTTTGGGGGCAAGTGG No data
1044468311_1044468316 -10 Left 1044468311 8:92534343-92534365 CCACAGTGTCTTTTCCAAGGCTT No data
Right 1044468316 8:92534356-92534378 TCCAAGGCTTTGGGGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044468316 Original CRISPR TCCAAGGCTTTGGGGGCAAG TGG Intergenic
No off target data available for this crispr