ID: 1044471307

View in Genome Browser
Species Human (GRCh38)
Location 8:92571958-92571980
Sequence CTCTTTCTGCATCTTATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044471302_1044471307 25 Left 1044471302 8:92571910-92571932 CCTCATCAGTGAAGGAAGAGGAC No data
Right 1044471307 8:92571958-92571980 CTCTTTCTGCATCTTATGACAGG No data
1044471306_1044471307 -5 Left 1044471306 8:92571940-92571962 CCTCAAAGGTGGAGCTGACTCTT No data
Right 1044471307 8:92571958-92571980 CTCTTTCTGCATCTTATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044471307 Original CRISPR CTCTTTCTGCATCTTATGAC AGG Intergenic
No off target data available for this crispr