ID: 1044478848

View in Genome Browser
Species Human (GRCh38)
Location 8:92661056-92661078
Sequence TACCCACCCATATTTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044478848_1044478849 -5 Left 1044478848 8:92661056-92661078 CCTGAATTAAATATGGGTGGGTA No data
Right 1044478849 8:92661074-92661096 GGGTAATTCAGACCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044478848 Original CRISPR TACCCACCCATATTTAATTC AGG (reversed) Intergenic
No off target data available for this crispr