ID: 1044479729

View in Genome Browser
Species Human (GRCh38)
Location 8:92671340-92671362
Sequence GTATGGGTAAGGAGCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044479729_1044479733 -8 Left 1044479729 8:92671340-92671362 CCTTCCTTGCTCCTTACCCATAC No data
Right 1044479733 8:92671355-92671377 ACCCATACCTCTAATTGGACTGG No data
1044479729_1044479735 -7 Left 1044479729 8:92671340-92671362 CCTTCCTTGCTCCTTACCCATAC No data
Right 1044479735 8:92671356-92671378 CCCATACCTCTAATTGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044479729 Original CRISPR GTATGGGTAAGGAGCAAGGA AGG (reversed) Intergenic
No off target data available for this crispr