ID: 1044479876

View in Genome Browser
Species Human (GRCh38)
Location 8:92672883-92672905
Sequence CTTTAGATAAGCAGGTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044479876_1044479880 24 Left 1044479876 8:92672883-92672905 CCATATCACCTGCTTATCTAAAG No data
Right 1044479880 8:92672930-92672952 ATTGAGAACAAATGTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044479876 Original CRISPR CTTTAGATAAGCAGGTGATA TGG (reversed) Intergenic
No off target data available for this crispr