ID: 1044487150

View in Genome Browser
Species Human (GRCh38)
Location 8:92767114-92767136
Sequence GACAGTTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044487150_1044487153 14 Left 1044487150 8:92767114-92767136 CCAGTAACAGGCCAAGAACTGTC No data
Right 1044487153 8:92767151-92767173 GTTATATGCAGAAGATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044487150 Original CRISPR GACAGTTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr