ID: 1044488667

View in Genome Browser
Species Human (GRCh38)
Location 8:92785610-92785632
Sequence GTGTGTGTGCGCGCGTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044488667_1044488668 -3 Left 1044488667 8:92785610-92785632 CCTATGCACGCGCGCACACACAC No data
Right 1044488668 8:92785630-92785652 CACACACACACAAATAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044488667 Original CRISPR GTGTGTGTGCGCGCGTGCAT AGG (reversed) Intergenic
No off target data available for this crispr