ID: 1044492253

View in Genome Browser
Species Human (GRCh38)
Location 8:92833479-92833501
Sequence GCTGCTGTGTAGAAACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044492252_1044492253 1 Left 1044492252 8:92833455-92833477 CCTTATGTTGTAAAAGGCTCACT No data
Right 1044492253 8:92833479-92833501 GCTGCTGTGTAGAAACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044492253 Original CRISPR GCTGCTGTGTAGAAACAGAC TGG Intergenic