ID: 1044493400

View in Genome Browser
Species Human (GRCh38)
Location 8:92847348-92847370
Sequence CCCTCCTTCCTCCCTTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044493394_1044493400 12 Left 1044493394 8:92847313-92847335 CCTACTGGCTACAAGGCTCCCAC No data
Right 1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG No data
1044493395_1044493400 -6 Left 1044493395 8:92847331-92847353 CCCACTAGTCACATTACCCCTCC No data
Right 1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG No data
1044493396_1044493400 -7 Left 1044493396 8:92847332-92847354 CCACTAGTCACATTACCCCTCCT No data
Right 1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044493400 Original CRISPR CCCTCCTTCCTCCCTTATGG AGG Intergenic
No off target data available for this crispr