ID: 1044499511

View in Genome Browser
Species Human (GRCh38)
Location 8:92936418-92936440
Sequence CTCCCCCTGTAATAATGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044499511_1044499515 10 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499515 8:92936451-92936473 GAAAGATAGAGGATGAACAGAGG No data
1044499511_1044499518 18 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG No data
1044499511_1044499516 11 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499516 8:92936452-92936474 AAAGATAGAGGATGAACAGAGGG No data
1044499511_1044499517 14 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499517 8:92936455-92936477 GATAGAGGATGAACAGAGGGAGG No data
1044499511_1044499519 22 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499519 8:92936463-92936485 ATGAACAGAGGGAGGCAGGAAGG No data
1044499511_1044499514 -1 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499514 8:92936440-92936462 GAGAGAAGGAAGAAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044499511 Original CRISPR CTCCCCCTGTAATAATGAAT GGG (reversed) Intronic
911860923 1:102947310-102947332 CTCCCTGTATTATAATGAATTGG + Intronic
913119822 1:115729467-115729489 CTCCTCCTGGAATAATGCCTTGG - Intronic
917697963 1:177548111-177548133 CTCCACTTTCAATAATGAATAGG + Intergenic
918905806 1:190491410-190491432 CTTCCCTTGTAATACTGAACAGG - Intergenic
919396487 1:197055854-197055876 ATCCTCCTGTTGTAATGAATGGG - Exonic
921895522 1:220395917-220395939 CTCCACCTGTACTAAAGCATTGG - Intergenic
922392360 1:225157896-225157918 CTCCCATTGTAATAATGGAGTGG + Intronic
1069591910 10:69647372-69647394 CTCACCCTGTCATTATGGATGGG + Intergenic
1071679091 10:87686373-87686395 CTCCCCCTCTATTAACCAATGGG - Intronic
1072121273 10:92407367-92407389 CTTCCCCTGTCTTGATGAATTGG - Intergenic
1072380103 10:94859148-94859170 GTCCCCCAATAATAATGAAATGG + Intergenic
1074018468 10:109559817-109559839 CTCCCACTGTCTTGATGAATAGG + Intergenic
1074577062 10:114680174-114680196 CCTCCCGCGTAATAATGAATGGG - Intronic
1079047458 11:17118424-17118446 ATAGCTCTGTAATAATGAATGGG - Intronic
1083707613 11:64526906-64526928 CACCTGCTGCAATAATGAATTGG + Intergenic
1087317447 11:96619580-96619602 CTCTTTCTGTATTAATGAATAGG + Intergenic
1088744546 11:112794663-112794685 TTCCCCCTCCAACAATGAATAGG + Intergenic
1089084879 11:115808526-115808548 ATCCCCCTGTCTTGATGAATTGG - Intergenic
1093362855 12:18253432-18253454 CTCCCACTATAATATGGAATCGG - Intronic
1095731122 12:45508073-45508095 CTCCCTCTGCATTCATGAATAGG - Intergenic
1099201769 12:79686517-79686539 CCCACCCTGTAATATTGAATGGG - Intronic
1100099968 12:91091645-91091667 CTCACCCTGTAATGAGGAACAGG + Intergenic
1100469439 12:94876785-94876807 CTCCCCCTGGAATAAAAAAGGGG - Intergenic
1104541575 12:129670705-129670727 ATCCCCCTGTCTTGATGAATCGG + Intronic
1108254564 13:48598059-48598081 ATTCCCCTGTCATAATAAATTGG - Intergenic
1110292656 13:73825158-73825180 CTGCCCCTGTTATGATAAATTGG + Intronic
1113078043 13:106487738-106487760 CTCTACCTGGAATAATGAATCGG + Intergenic
1120416292 14:84222055-84222077 CTCACCCTCTAATAAAGGATAGG - Intergenic
1127466426 15:59248942-59248964 CTGCCTATGCAATAATGAATTGG + Intronic
1132742562 16:1422492-1422514 CTCCCCCTGTCTTGATAAATTGG + Intergenic
1132834227 16:1944671-1944693 ATTCCCCTGTCTTAATGAATCGG + Exonic
1135259312 16:20967106-20967128 CTCCTCTTGTAATTAGGAATGGG - Intronic
1140269386 16:73450796-73450818 CTCCCCCTGTAAGAAAGATGAGG - Intergenic
1142922638 17:3203772-3203794 ATCCCACTTTGATAATGAATAGG + Intergenic
1146366921 17:32236264-32236286 TTCCCCCTGTATTTATTAATTGG + Intronic
1146909408 17:36638926-36638948 CGCCCCCTGGAAGAATTAATTGG - Intergenic
1153350204 18:4071824-4071846 TTCTCTCTGTAATGATGAATGGG - Intronic
1163133326 19:15290513-15290535 CCACCCCTTTAATAATAAATGGG + Intronic
1166839354 19:45687175-45687197 CTCTACCTCTTATAATGAATTGG - Intergenic
927273366 2:21238647-21238669 TTCCCCATGGATTAATGAATGGG + Intergenic
927316934 2:21694547-21694569 CTCCCCCTTAACTAATGAATTGG + Intergenic
928035914 2:27822827-27822849 CTCACTCTGTAATAACGCATGGG - Intronic
929718443 2:44338495-44338517 ATACCCCTGCAATTATGAATTGG - Exonic
930115372 2:47713541-47713563 CTGCCTCTGTGATAATGAACTGG - Intronic
930530505 2:52582652-52582674 CTGTTCTTGTAATAATGAATGGG - Intergenic
932985130 2:76716762-76716784 CTCCCTCTGAAGTAAAGAATAGG - Intergenic
933463090 2:82614032-82614054 CACCCCCAGTAACAATGACTTGG - Intergenic
936969769 2:118165626-118165648 CTCTTCCTGTGATAGTGAATGGG + Intergenic
938113892 2:128590575-128590597 GTCCCTCTGTAAGGATGAATGGG - Intergenic
938787292 2:134642431-134642453 CTCCAACTGTAATTATGGATTGG - Intronic
1169773447 20:9226276-9226298 CTCCTCATGTAATAATAAAGCGG + Intronic
1173927039 20:46788377-46788399 CTTTCCCTGAAATAATGAACCGG + Intergenic
1174159783 20:48542683-48542705 CTCTTCCTGTGATAGTGAATGGG - Intergenic
1177093245 21:16797605-16797627 TTCCCCCTGGCATAATGAAAAGG - Intergenic
950142559 3:10625445-10625467 CTCCCGCTGAACTACTGAATGGG + Intronic
951572104 3:24075216-24075238 CAGCCACTGTAATACTGAATGGG - Intergenic
956524691 3:70144708-70144730 CTGTTCCTGTGATAATGAATGGG + Intergenic
959263928 3:104114144-104114166 CTCACCCAGTAAGAAAGAATGGG - Intergenic
960362348 3:116728786-116728808 CTCCCTCTGCAATAATCTATTGG + Intronic
960920698 3:122745117-122745139 CTCCCCTATTATTAATGAATTGG + Intronic
961313952 3:126021614-126021636 GTCCCCCTGAAATAATGAGCAGG - Intronic
961759681 3:129157395-129157417 CTCCAGCTCTAATATTGAATAGG - Intronic
965500585 3:169451351-169451373 CTCTACTTGTAAAAATGAATAGG + Intronic
968146481 3:196303351-196303373 ATTCCCCTGTCATGATGAATCGG + Intronic
971238071 4:24861816-24861838 CTCTCGCTGTAATAAGAAATGGG + Intronic
972194440 4:36636389-36636411 CCCCTGCTGTAAGAATGAATGGG + Intergenic
973277125 4:48321861-48321883 CTCCCTCTCTGATAATGACTAGG + Intergenic
975094712 4:70444541-70444563 CTCCCCATCTAATACTGAAATGG + Intronic
978258895 4:106727596-106727618 CACCACCTGAAATAATGGATAGG + Intergenic
980710620 4:136562110-136562132 CTCTCCCTGTCATTTTGAATTGG + Intergenic
981947633 4:150366948-150366970 CTTCCCCTTTCAAAATGAATGGG - Intronic
987682245 5:21152367-21152389 ATCACCTTTTAATAATGAATAGG + Intergenic
988273282 5:29046124-29046146 ATTTCCCTGTAATAATAAATTGG + Intergenic
991278893 5:64887254-64887276 CTCCCTTTGAAATAATAAATAGG + Intronic
995095005 5:108225454-108225476 CTCCGCCAGTTATATTGAATTGG - Intronic
1000940235 5:167351759-167351781 CTGCCCCTTAAATAATGACTTGG - Intronic
1008329842 6:50231757-50231779 CTCCCCCTTTCAAAATAAATCGG - Intergenic
1008883416 6:56405547-56405569 CACCCCCTGTAAAAATGGACTGG - Intergenic
1009058517 6:58368744-58368766 CTCCCCATGTTATAATCAAAGGG + Intergenic
1009232322 6:61078376-61078398 CTCCCCATGTTATAATCAAAGGG - Intergenic
1013040599 6:106429595-106429617 CTCCACCTTTAATAATAAAATGG - Intergenic
1015405345 6:132830643-132830665 CTTCCCCTGTAAAAGTGAAATGG + Intergenic
1015510888 6:134037280-134037302 CTGGCCCTTTAAAAATGAATAGG - Intronic
1019084389 6:169461191-169461213 CTCCTCTTCTAATAATGGATAGG + Intronic
1024336927 7:48218157-48218179 TTTCCCCTGTAATAATGAGCAGG - Intronic
1028229318 7:88287426-88287448 ATCCCCCTGTCATGATAAATTGG - Intronic
1034457145 7:151176790-151176812 ATCCCCCTGTACCTATGAATGGG + Intronic
1041240971 8:55848766-55848788 CTCCCCCGGTAATCAAAAATAGG - Intergenic
1042409614 8:68448138-68448160 TTCTCCCTGTAATGATGAAGTGG - Intronic
1044499511 8:92936418-92936440 CTCCCCCTGTAATAATGAATGGG - Intronic
1046209831 8:111056277-111056299 CTCCACTTTTAATAATGAATAGG - Intergenic
1046260530 8:111761474-111761496 CTCCAACTGTAATAATCTATTGG - Intergenic
1056658082 9:88525086-88525108 CTCCCCCTGTAACAGGGAAGAGG - Intergenic
1057709239 9:97422552-97422574 CCTCCACTGTGATAATGAATGGG + Intronic
1057874134 9:98740497-98740519 CTCACCCTGAGATAATGAATGGG + Intronic
1058574720 9:106388322-106388344 CCCCTTCTGTAAAAATGAATAGG - Intergenic
1059670327 9:116484997-116485019 CTCCTTCTGTATTAGTGAATAGG + Intronic
1061303844 9:129721532-129721554 TGCCCCCTGTAACGATGAATAGG - Intronic
1187231569 X:17428539-17428561 CTCCTCCTTTAATAAAGAAAGGG - Intronic
1188426260 X:30050542-30050564 ATCCCCCTATAATAATGCAGTGG - Intergenic
1189435075 X:40985420-40985442 GACCCCTTTTAATAATGAATAGG + Intergenic
1190384589 X:49872481-49872503 CTCCCTTGGTAATCATGAATGGG + Intergenic
1192269790 X:69568014-69568036 CTCCTCCACTAATCATGAATTGG + Intergenic
1195101064 X:101554052-101554074 TTCCCTCTTTAATAAAGAATGGG + Exonic
1196273713 X:113741667-113741689 CTCCCTCTGAAAAAAGGAATTGG + Intergenic
1198973368 X:142306035-142306057 TTCCTAATGTAATAATGAATAGG + Intergenic
1201668275 Y:16484863-16484885 CTAACCCTGTAATTTTGAATTGG + Intergenic