ID: 1044499512

View in Genome Browser
Species Human (GRCh38)
Location 8:92936419-92936441
Sequence TCTCCCCCTGTAATAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044499512_1044499518 17 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG No data
1044499512_1044499515 9 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499515 8:92936451-92936473 GAAAGATAGAGGATGAACAGAGG No data
1044499512_1044499514 -2 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499514 8:92936440-92936462 GAGAGAAGGAAGAAAGATAGAGG No data
1044499512_1044499517 13 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499517 8:92936455-92936477 GATAGAGGATGAACAGAGGGAGG No data
1044499512_1044499519 21 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499519 8:92936463-92936485 ATGAACAGAGGGAGGCAGGAAGG No data
1044499512_1044499516 10 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499516 8:92936452-92936474 AAAGATAGAGGATGAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044499512 Original CRISPR TCTCCCCCTGTAATAATGAA TGG (reversed) Intronic
900510753 1:3059731-3059753 GCTCCAGCTGTAAAAATGAAAGG + Intergenic
902936382 1:19767785-19767807 TCTCCACCTGTGAAAATGAGAGG + Intronic
907245887 1:53108921-53108943 TTTCCCCATTTAATAATCAAAGG - Intronic
907481392 1:54747808-54747830 CCTGCCCCTGTAATACTGCATGG + Intergenic
909920924 1:81379412-81379434 TCTCTCCTTGTGATAAGGAAGGG - Intronic
910972424 1:92869822-92869844 TCTCCCTCTGTATTAGTGCATGG - Intronic
918813381 1:189150068-189150090 TCTGTCCTTGTAATAAGGAAGGG + Intergenic
920641360 1:207754476-207754498 TCTCACCCTGTCAGAATGCAGGG + Intronic
924448280 1:244154968-244154990 TCTCCCCCTGTGATCATCAGAGG + Intergenic
924903460 1:248426989-248427011 TCTGTCCCTGATATAATGAACGG - Intergenic
924924389 1:248664647-248664669 TCTATCCCTGATATAATGAACGG + Intergenic
924924392 1:248664689-248664711 TCTATCCCTGATATAATGAACGG + Intergenic
924924400 1:248664813-248664835 TCTATCCCTGATATAATGAACGG + Intergenic
1063183932 10:3633627-3633649 TCTCTCCCAGTGAAAATGAATGG + Intergenic
1063854405 10:10231688-10231710 TCTCCACCTCTAAGAAGGAAGGG + Intergenic
1063940096 10:11119752-11119774 CCTCCCCCTATAATGATCAAGGG + Intronic
1065785809 10:29213668-29213690 TCTCCCCAAGTAATAAAAAATGG + Intergenic
1074951338 10:118340105-118340127 TCTTTTCCTGTAATGATGAATGG - Intronic
1078849860 11:15153793-15153815 TTTCCCCATCTTATAATGAAGGG - Intronic
1079047459 11:17118425-17118447 TATAGCTCTGTAATAATGAATGG - Intronic
1080925297 11:36749941-36749963 TCTACTCCTGAAATAATGAAAGG + Intergenic
1083150085 11:60786491-60786513 TCTCCCCCTGTAAGCAGGATGGG + Intronic
1087788056 11:102377076-102377098 TCTCCCTATGTAAAAATGAGAGG + Intronic
1089798951 11:121007794-121007816 TCTCCTTCTGTTAAAATGAAGGG - Intergenic
1091412147 12:249973-249995 TCTCCAGCTGTTATAATAAATGG + Intronic
1091616603 12:2054506-2054528 GCTCCCCCTGTGATGGTGAAAGG + Intronic
1095129475 12:38522144-38522166 TCTCCACCTGTAATCATGCTAGG - Intergenic
1099201771 12:79686518-79686540 CCCCACCCTGTAATATTGAATGG - Intronic
1099432755 12:82607371-82607393 TCTCAAGATGTAATAATGAAGGG + Intergenic
1100469440 12:94876786-94876808 CCTCCCCCTGGAATAAAAAAGGG - Intergenic
1100969234 12:100049513-100049535 TCTCCACCTGGAATTGTGAATGG - Intronic
1102956599 12:117063037-117063059 TGTCCCCCTGGAGTCATGAAGGG + Intronic
1108777950 13:53789184-53789206 TCTACCTCTTTAATAATGCAAGG + Intergenic
1110290798 13:73804695-73804717 TCTCCCCTGGCAAGAATGAATGG + Intronic
1118211407 14:63769272-63769294 CCTACCCCTGTAATATTTAATGG - Intergenic
1118345549 14:64938200-64938222 TCTTCCTCTGTAAGAAGGAAGGG - Intronic
1126485844 15:49179904-49179926 CCTAACCCTCTAATAATGAATGG - Intronic
1126607181 15:50490006-50490028 TCTCACCCTGTTATAATTAGGGG - Intronic
1131594774 15:93786104-93786126 TCTCTCCCTGTAATACTGGCAGG - Intergenic
1135259313 16:20967107-20967129 TCTCCTCTTGTAATTAGGAATGG - Intronic
1138067294 16:53955480-53955502 TCTCCCTCTGTCATATTGACTGG - Intronic
1138176202 16:54900479-54900501 TTTCCACCTGTTATGATGAAGGG - Intergenic
1140874742 16:79140331-79140353 ACTCCCTCTGTACAAATGAAGGG - Intronic
1144343471 17:14330371-14330393 TCTCCGCGTGTAAAAATTAATGG - Intronic
1146085023 17:29819928-29819950 TCTTGGCCTGTAATAAGGAAAGG + Intronic
1149008608 17:51831849-51831871 TTGCCCCCTGTAATAAAGCATGG - Intronic
1157537320 18:48469461-48469483 TCTCCCCCAGGAATATTGATTGG - Intergenic
1168517846 19:57023215-57023237 TCCCCCCCAGAAAAAATGAAAGG - Intergenic
926418831 2:12677546-12677568 TCTTTCCCTGTTATAATGAAGGG - Intergenic
929831908 2:45354137-45354159 TCTGCCCCTGTGATGAGGAAAGG - Intergenic
931179737 2:59887457-59887479 TCTCCCTCTCTAATAGGGAAAGG + Intergenic
931415893 2:62080043-62080065 TTTCCTCCTGTAGTAATGACTGG + Intronic
931487924 2:62712206-62712228 TCTCCCCTTGTAACAATGAATGG - Intronic
931721642 2:65071438-65071460 TCTCCACCTGCAATGATCAAAGG - Exonic
931848520 2:66229743-66229765 TTTCCCCCTGTAGTAGTCAAAGG + Intergenic
932430554 2:71671528-71671550 TCTCCACCTGTCATGAGGAAGGG - Intronic
935870085 2:107438793-107438815 TCTCCCATTGTCGTAATGAATGG - Intergenic
938676674 2:133642677-133642699 TGTCCCCTTGTAATATTGACAGG + Intergenic
940697979 2:157003594-157003616 TCTTCCACTGTGATAAGGAAGGG + Intergenic
941737644 2:168996972-168996994 TCTCTGCCTATAAAAATGAAGGG - Intronic
946067051 2:216996868-216996890 TCTGCCCCAATAAGAATGAAAGG + Intergenic
946088249 2:217196161-217196183 TGTTCCCCTGTAATAATCACGGG + Intergenic
1172074312 20:32282346-32282368 TCTGCCTCTGAAATGATGAAAGG + Intronic
1173036876 20:39420248-39420270 TGTGCCCCTGTCATAATAAATGG - Intergenic
1173724404 20:45287217-45287239 TCTCCCCCTGGAACAATGGAAGG + Intergenic
1181571676 22:23771314-23771336 ACACCCCCTGAAATGATGAAGGG - Intronic
1181642097 22:24207270-24207292 ACTTCCCCTGTAATACTGGAAGG + Intergenic
1184489872 22:44802362-44802384 GCTCCCACTGTGCTAATGAATGG - Intronic
1184862472 22:47181411-47181433 AATCCAACTGTAATAATGAAGGG + Intergenic
949645234 3:6085555-6085577 TCTCCCCCTGTAGAAAGGAAAGG + Intergenic
951036265 3:17935802-17935824 TCTCTCCCTTTCACAATGAATGG - Intronic
951396995 3:22181175-22181197 TCTTCTCCTTTAATAGTGAAAGG - Intronic
953874645 3:46659689-46659711 TCTCCTGCTGTAATCATTAAGGG + Intergenic
958633881 3:96717357-96717379 TCTCCCCATAAAATAATGATAGG + Intergenic
959263929 3:104114145-104114167 TCTCACCCAGTAAGAAAGAATGG - Intergenic
960162079 3:114361494-114361516 CCTCCACCTGTAGGAATGAATGG + Intronic
967800823 3:193657548-193657570 TTACCCTCTGTGATAATGAAAGG + Intronic
970200973 4:13604903-13604925 TCTACCCCTGTTATCATGGAGGG - Exonic
970905805 4:21214804-21214826 TCTCTCCCTGGAATTATGCATGG - Intronic
971238070 4:24861815-24861837 TCTCTCGCTGTAATAAGAAATGG + Intronic
971937540 4:33171715-33171737 TCTACACATGAAATAATGAATGG + Intergenic
974455894 4:62128935-62128957 TCTCCCCATGTAAGTAGGAAAGG + Intergenic
978041770 4:104073420-104073442 TTTCCACCAGTAATACTGAAGGG - Intergenic
978223409 4:106304763-106304785 TCTCCCTCTGTAAAGATGAAAGG + Intronic
978918450 4:114152476-114152498 TTTCCCACGGTATTAATGAAAGG - Intergenic
981947634 4:150366949-150366971 TCTTCCCCTTTCAAAATGAATGG - Intronic
984887110 4:184459369-184459391 TCTCCAGCTGAAAAAATGAAGGG + Intronic
986852111 5:11825791-11825813 TTTTCCCCTGAAATTATGAAAGG + Intronic
990844305 5:60120528-60120550 TCTTCCCCTGGGATAATGATGGG + Intronic
991291873 5:65041280-65041302 TCACACCCTGTGATATTGAATGG - Intergenic
996125001 5:119715051-119715073 TGTCCCCATGTAATATTTAAAGG + Intergenic
997202359 5:132018604-132018626 TCTCCCTAGGGAATAATGAATGG - Intergenic
997348770 5:133214698-133214720 CTTCCTCCTGTTATAATGAAAGG + Intronic
998534927 5:142920889-142920911 TCGTCCCCTGTAAGAATGGAAGG - Intronic
999893497 5:156004146-156004168 TCTCCCCCTGAAATAAGGACTGG - Intronic
1000852445 5:166357077-166357099 TTTCCCTATGTAATAATGAGGGG + Intergenic
1006318662 6:33305763-33305785 TCTTCGCCTGTAATCAAGAAAGG - Intronic
1009058516 6:58368743-58368765 CCTCCCCATGTTATAATCAAAGG + Intergenic
1009232323 6:61078377-61078399 CCTCCCCATGTTATAATCAAAGG - Intergenic
1009601474 6:65806593-65806615 TTTCCCCCTGTAATTTAGAATGG + Intergenic
1013194476 6:107833156-107833178 ACTCCCCTTGTAAGAAAGAATGG - Intergenic
1013613925 6:111823516-111823538 TTTCCCCCTTTTATAAAGAATGG + Intronic
1016259448 6:142150473-142150495 TCTCCCACTTTAATGAAGAACGG + Intronic
1017225096 6:152012064-152012086 TCTCTCTCTGTCATTATGAATGG + Intronic
1017526974 6:155249776-155249798 TATCCAACAGTAATAATGAATGG - Intronic
1018778123 6:167037397-167037419 TTTCACTCTGTAATAATGATGGG + Intronic
1027056265 7:75052080-75052102 TCTTCCCCTGTAATTCTGGAAGG + Intronic
1027793614 7:82663180-82663202 TTTCCCCCTGTACGATTGAAAGG + Intergenic
1034457144 7:151176789-151176811 TATCCCCCTGTACCTATGAATGG + Intronic
1035610290 8:957579-957601 TATCCCTCTGAAATAATGACAGG - Intergenic
1040898651 8:52394129-52394151 CATCCCCCTGTCTTAATGAAGGG + Intronic
1042420793 8:68586157-68586179 TCTCCCCCTCTAATGTAGAAAGG - Intronic
1042445534 8:68880936-68880958 TCACCCACTGTAACATTGAATGG - Intergenic
1044499512 8:92936419-92936441 TCTCCCCCTGTAATAATGAATGG - Intronic
1048720525 8:137319295-137319317 TTCCACCCTGTAATAATGAGGGG - Intergenic
1048953299 8:139513740-139513762 TCACCCCCTGCAGTAATGAGGGG - Intergenic
1051650637 9:19320866-19320888 TCTCCACAAGTTATAATGAAAGG - Intronic
1052276091 9:26678363-26678385 TCTGCTCCTGTAACAGTGAAGGG + Intergenic
1055530226 9:77177096-77177118 TCCCACCCTGTAATGATGAGGGG + Intergenic
1057874133 9:98740496-98740518 GCTCACCCTGAGATAATGAATGG + Intronic
1059573150 9:115461982-115462004 TCTGCCTCTGTAACAAGGAATGG - Intergenic
1059651272 9:116318539-116318561 TCTCACCCTGTAAGAATACAAGG + Intronic
1059873777 9:118608607-118608629 TCATCCCCTCTAATACTGAATGG + Intergenic
1187231570 X:17428540-17428562 CCTCCTCCTTTAATAAAGAAAGG - Intronic
1192285314 X:69728847-69728869 TTTCCCCCATAAATAATGAATGG + Intronic
1195101063 X:101554051-101554073 TTTCCCTCTTTAATAAAGAATGG + Exonic
1197012233 X:121579955-121579977 TCTCCCCCTGAAACAGTGTAAGG - Intergenic
1197861448 X:130975197-130975219 TCTCCCCTTTCCATAATGAATGG - Intergenic
1198732355 X:139745939-139745961 TTTGACCCTGTTATAATGAAGGG + Intronic
1200383425 X:155864678-155864700 TCTCTCCCAGTCTTAATGAATGG + Intergenic