ID: 1044499518

View in Genome Browser
Species Human (GRCh38)
Location 8:92936459-92936481
Sequence GAGGATGAACAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044499511_1044499518 18 Left 1044499511 8:92936418-92936440 CCCATTCATTATTACAGGGGGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG No data
1044499512_1044499518 17 Left 1044499512 8:92936419-92936441 CCATTCATTATTACAGGGGGAGA 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044499518 Original CRISPR GAGGATGAACAGAGGGAGGC AGG Intronic
No off target data available for this crispr