ID: 1044500754

View in Genome Browser
Species Human (GRCh38)
Location 8:92952760-92952782
Sequence CCTTCTATCCAGAGGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 7, 3: 102, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044500754 Original CRISPR CCTTCTATCCAGAGGGAAAG GGG (reversed) Intronic
900357586 1:2272161-2272183 CCATCTGTGCAGAGGGCAAGAGG - Intronic
901767910 1:11515560-11515582 CTTTGTATCCAGGGAGAAAGGGG - Intronic
902057448 1:13613673-13613695 CTTTCTATTCACAGAGAAAGTGG + Exonic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
904681268 1:32230998-32231020 CCTTCCATCCTGATGGCAAGAGG + Exonic
907118320 1:51989157-51989179 CCTGGAATCCAGATGGAAAGGGG - Intronic
908046738 1:60178678-60178700 TCTTGGATCCAGAGGGAGAGAGG - Intergenic
908452823 1:64273053-64273075 ACTGGTATCCAGAGGGAGAGAGG + Intergenic
908592648 1:65650594-65650616 CCTCCCCTCCAGAGTGAAAGGGG - Intergenic
910044662 1:82897799-82897821 CCTTCTATACCAAGGGAAACAGG - Intergenic
911394117 1:97285129-97285151 CCTTCTATACAGAGTGTTAGAGG - Intronic
913443644 1:118926305-118926327 CATTCTATCCAGAGACACAGGGG + Intronic
914000224 1:143687848-143687870 TCTTCTGTCCAGAGGAAGAGGGG - Intergenic
914197528 1:145455877-145455899 TCTTCTGTCCAGAGGAAGAGGGG - Intergenic
914476632 1:148028970-148028992 TCTTCTGTCCAGAGGAAGAGGGG - Intergenic
916155511 1:161842363-161842385 GTTTCTACCCAGAGGAAAAGAGG + Intronic
916213816 1:162379302-162379324 CCTTCTATTCAAAGTGAAAGTGG - Intronic
916324247 1:163539444-163539466 CCATCTATAGAGAGGGAAACAGG - Intergenic
916834725 1:168532122-168532144 CCTTCTTTCCAGAGCTAATGAGG + Intergenic
916985007 1:170181679-170181701 CCTTCTTTCCACAGTGAAACAGG + Intergenic
917147161 1:171904604-171904626 CCTTCTTTCCTGAGAGAAACTGG - Intronic
917695812 1:177522366-177522388 CGTTCTATTCAGAGGAAAATGGG - Intergenic
919820197 1:201467872-201467894 CATTCAACCTAGAGGGAAAGAGG + Intronic
920385524 1:205568523-205568545 CCTTCTGTTCTGGGGGAAAGGGG + Intergenic
923338987 1:232992093-232992115 CCTTCTTTTAAGTGGGAAAGGGG + Intronic
923659551 1:235946355-235946377 ACTTCTCTCCAGACGGAAAATGG - Intergenic
924860158 1:247911900-247911922 TCTAATATCCAGATGGAAAGGGG + Intergenic
1064354013 10:14601803-14601825 ACTTCTCTCCTGATGGAAAGAGG - Intronic
1064396100 10:14983335-14983357 CCTAATATCCAGAGGGGGAGAGG + Intronic
1064396893 10:14989642-14989664 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064396902 10:14989717-14989739 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1064396969 10:14990097-14990119 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1064399811 10:15012112-15012134 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064399822 10:15012187-15012209 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1064974714 10:21101443-21101465 CCTTCTTGTTAGAGGGAAAGTGG + Intronic
1065504201 10:26413098-26413120 CATTCCAACCAGCGGGAAAGAGG + Intergenic
1065602264 10:27381141-27381163 CCTTCTAACCAGTGACAAAGGGG + Intergenic
1067508097 10:46873437-46873459 TCTTCTAGGCAGAGGGACAGCGG + Intergenic
1067702942 10:48586905-48586927 GCTCCTATGGAGAGGGAAAGGGG - Intronic
1068649694 10:59508476-59508498 GCTGCAACCCAGAGGGAAAGCGG - Intergenic
1071152778 10:82654165-82654187 CCTTCACTTAAGAGGGAAAGGGG - Intronic
1072001232 10:91197651-91197673 CCTTGCTTCCAGAGGGAAAATGG + Intronic
1074557219 10:114502451-114502473 CCTTCTTTGTAGGGGGAAAGAGG + Intronic
1075189629 10:120294968-120294990 CCTTCTAACCAGAAGGAATCAGG - Intergenic
1075747512 10:124737959-124737981 CCTTCTTTCCAGATTGAAGGGGG - Intronic
1076430175 10:130396269-130396291 CCTTGGATACAGAGGGAATGCGG + Intergenic
1077177273 11:1196566-1196588 CCTTCTCACCGGAGGGAAAAAGG + Intronic
1079038657 11:17042409-17042431 CCTAATATCCAGAGCAAAAGAGG - Intergenic
1079038669 11:17042484-17042506 CCTAATATCCAGAGGGCAAGAGG - Intergenic
1079038707 11:17042705-17042727 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1079038733 11:17042819-17042841 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1079854763 11:25588679-25588701 CCTTGTATGCCCAGGGAAAGAGG - Intergenic
1081448737 11:43153380-43153402 CCTAATATCCAGAGGGGGAGTGG + Intergenic
1081450827 11:43169494-43169516 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1081827914 11:46076005-46076027 CTTTCTAACCAGAGGGAGAGTGG + Intronic
1082784462 11:57309274-57309296 CCTTCTAGCAAGATGGAAGGTGG - Exonic
1082936734 11:58663624-58663646 CCTAATATCCAAAGGGAGAGAGG - Intronic
1082936807 11:58664117-58664139 CCTAATATCCAGGGGGAGAGAGG - Intronic
1084227374 11:67725623-67725645 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084227386 11:67725698-67725720 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1084227452 11:67726078-67726100 CCTAATATCCAGGGGGAAAGAGG + Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084260804 11:67977395-67977417 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084260876 11:67977774-67977796 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1084807748 11:71590786-71590808 CCTAATGTCCAGGGGGAAAGAGG - Intronic
1084807806 11:71591149-71591171 CCTAATATCCAGAGCGAAAGAGG - Intronic
1084811774 11:71616343-71616365 CCTAATATCCAGGGGGAAAGAGG - Intergenic
1084811840 11:71616722-71616744 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1084811849 11:71616797-71616819 CCTAATATCCACAGGGAGAGAGG - Intergenic
1084811863 11:71616872-71616894 CCTCATATCCAGAGGGCGAGAGG - Intergenic
1084844854 11:71890790-71890812 CCTAATATCCAGGGGGGAAGAGG - Intronic
1084844934 11:71891243-71891265 CCTAATATCCACAGGGAGAGAGG - Intronic
1084847618 11:71912712-71912734 CCTAATATCCAGGGGGAAAGAGG - Intronic
1084847687 11:71913132-71913154 CCTAATATCCAGAGCGAAAGAGG - Intronic
1084847698 11:71913207-71913229 CCTAATATCCACAGGGAGAGAGG - Intronic
1085859053 11:80210942-80210964 CTTTCTTTCCAGAGGTAGAGGGG + Intergenic
1086182195 11:83966203-83966225 TCATCTTTCCAGAGGGAAACAGG - Intronic
1086444304 11:86857992-86858014 CCTAATATCCAGAAGGCAAGAGG + Intronic
1086444534 11:86859415-86859437 TCTACTATCCAAAGGGGAAGAGG + Intronic
1086888909 11:92233959-92233981 CCTCATATCCAAAGAGAAAGAGG + Intergenic
1087265980 11:96061653-96061675 CCTTTTATCTAGGAGGAAAGTGG - Intronic
1088506385 11:110531822-110531844 CTCTCTCTCCAGAGGGGAAGTGG + Intergenic
1088923080 11:114275954-114275976 CCTTCTTTCCAGAGAGAAGTGGG + Intronic
1089130447 11:116208078-116208100 CTTTTTCTCTAGAGGGAAAGTGG + Intergenic
1089188604 11:116637820-116637842 CCTGCTCTCCAGAGGTAAATGGG - Intergenic
1092432051 12:8417871-8417893 CCTAATATCCACAGGGAGAGAGG + Intergenic
1092432062 12:8417946-8417968 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1092432093 12:8418100-8418122 CCTAGTATCCAGGGGGAGAGAGG + Intergenic
1092432131 12:8418326-8418348 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1092435094 12:8441191-8441213 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1092435558 12:8444385-8444407 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1093505076 12:19855676-19855698 CTTTTTACCCAGAAGGAAAGTGG - Intergenic
1095697005 12:45154840-45154862 CATAATATCCAGGGGGAAAGAGG + Intergenic
1095939537 12:47717084-47717106 CCTCAGAGCCAGAGGGAAAGGGG + Intronic
1096506823 12:52098934-52098956 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096506890 12:52099377-52099399 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1096506913 12:52099475-52099497 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1096508686 12:52114759-52114781 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508698 12:52114833-52114855 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508708 12:52114908-52114930 CGTAATATCCAGAGCGAAAGAGG + Intergenic
1096508774 12:52115287-52115309 CCTAATATCCAGCGGGGAAGAGG + Intergenic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097434960 12:59544749-59544771 CCTAATATACAGCGGGAAAGGGG + Intergenic
1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG + Intergenic
1097435931 12:59551837-59551859 CGTAATATCCAGGGGGAAAGAGG + Intergenic
1098479519 12:70942762-70942784 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1099180209 12:79467780-79467802 CCTTACACCCAGGGGGAAAGAGG + Intergenic
1099181253 12:79474354-79474376 CCTAATATCCAGGCGGAAAGAGG + Intergenic
1101230739 12:102738408-102738430 CCCTCTTTCCAATGGGAAAGAGG + Intergenic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1103167837 12:118785461-118785483 CATACTATCCAGAAGGAAATGGG + Intergenic
1107114223 13:36729245-36729267 CCTGCCATCCCCAGGGAAAGTGG - Intergenic
1107408642 13:40138608-40138630 TCTTCCATCAAGTGGGAAAGAGG + Intergenic
1107548495 13:41455323-41455345 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1107548518 13:41455473-41455495 CCTACTATCCAGAGGGAGAGAGG - Intergenic
1107655382 13:42587974-42587996 TCTTGTATACAAAGGGAAAGAGG - Intronic
1109154659 13:58892125-58892147 CCTGCTATCCATTGGCAAAGTGG - Intergenic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1109667856 13:65562782-65562804 CCTTAAATACAGAGGGAAATTGG - Intergenic
1110001344 13:70206060-70206082 CATTCTACACAGAAGGAAAGTGG - Intergenic
1111809996 13:93088359-93088381 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1111810634 13:93092797-93092819 CCTTATATCGAGAGGGAGATAGG + Intergenic
1111811021 13:93095125-93095147 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1111811037 13:93095201-93095223 CCTAATATCCAGTGGGGAAGAGG + Intergenic
1112796875 13:103066826-103066848 CCTTCTATTGAAAGGGAAATGGG - Exonic
1114240098 14:20858998-20859020 CTTCCTATCCAGCTGGAAAGTGG - Intergenic
1114436328 14:22710439-22710461 CATAATATCCAGGGGGAAAGAGG - Intergenic
1114437020 14:22714854-22714876 CCTAATATCCAGAGCGAGAGAGG + Intergenic
1116420290 14:44724246-44724268 CATTCTTTCCAGATGGAAAATGG - Intergenic
1116517425 14:45818534-45818556 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1116517641 14:45819836-45819858 CCTTATATCCAGGGTGAAAGAGG - Intergenic
1116517821 14:45821074-45821096 CCTAATATCCAGAGGGTAAGAGG + Intergenic
1116518670 14:45826619-45826641 CCTAATATCCAGGGGGAAAGAGG + Intergenic
1116519297 14:45830752-45830774 CCTAATATCCAGTGGGAGAGAGG + Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116519623 14:45832822-45832844 TCTTATATCCAGGGAGAAAGAGG - Intergenic
1116519676 14:45833112-45833134 TCTTATATCCAGGGAGAAAGAGG - Intergenic
1116519710 14:45833328-45833350 CCTAATATCCACAGGGGAAGAGG - Intergenic
1117039042 14:51753268-51753290 CCTAATATCCAGGGGGGAAGAGG - Intergenic
1117039112 14:51753648-51753670 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1117039123 14:51753723-51753745 CCTAATATCCACAGGGAGAGAGG - Intergenic
1117041582 14:51773720-51773742 CCTAGTATCCCGAGGGAGAGAGG + Intergenic
1123439712 15:20281620-20281642 GCTTGTTTTCAGAGGGAAAGCGG - Intergenic
1124942922 15:34235065-34235087 CCTTCCTTAAAGAGGGAAAGTGG + Intronic
1124954907 15:34353972-34353994 GCCACTCTCCAGAGGGAAAGTGG - Intronic
1125488972 15:40132494-40132516 CCTACTATTCAGTGGGAAGGAGG + Intergenic
1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG + Intergenic
1126097431 15:45099530-45099552 CCTCCGATCCTGAGGGAGAGAGG + Intronic
1129384232 15:75186852-75186874 CCTTGTATGCCCAGGGAAAGAGG - Intergenic
1130188739 15:81711776-81711798 CCTTATATCCAAAGGTAGAGAGG + Intergenic
1130561956 15:84965788-84965810 CATTCTAGCCAGAAGGAAAGAGG - Intergenic
1131211343 15:90499455-90499477 CTTTCTATCCCGAAGGCAAGGGG - Intronic
1131655881 15:94458284-94458306 CCTGCTATCCACAAGGACAGTGG + Intronic
1132152746 15:99474252-99474274 CTTTGTATCCACAGGGAAATGGG - Intergenic
1132214445 15:100052331-100052353 CTTTCTATATAGAGGCAAAGGGG + Intronic
1133097295 16:3456393-3456415 TCTTCTAGCCAGTGGGAAAGGGG + Intronic
1133254986 16:4511273-4511295 CCTTCTTTTTTGAGGGAAAGAGG - Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133991317 16:10709727-10709749 TCTAATATCCAGAGGGGAAGAGG - Intergenic
1138046709 16:53732631-53732653 CCTTTTATCAGAAGGGAAAGTGG - Intronic
1140368224 16:74397862-74397884 CCCACTATGCAGAGGAAAAGGGG + Intergenic
1140895545 16:79321410-79321432 CATTTTATCCAGAGGAAGAGAGG + Intergenic
1141843944 16:86594190-86594212 CCTTCTCACCAAAGGGGAAGGGG - Intergenic
1143698681 17:8640550-8640572 CTTTCCATCCTGATGGAAAGAGG + Intergenic
1144076281 17:11722434-11722456 CATTCAAACCAGAGGGAATGAGG + Intronic
1149928657 17:60727369-60727391 CCTTGTATGCCCAGGGAAAGAGG - Intronic
1151944589 17:77312448-77312470 CCTGCTTTCCAGAGGACAAGTGG - Intronic
1152283910 17:79401536-79401558 CCTTCAGTGCAGAGGGAGAGGGG + Intronic
1153119664 18:1706028-1706050 CCTACTCTCCAGAGGAAAAAAGG - Intergenic
1153664243 18:7354003-7354025 AGTTCTATTCAGAGAGAAAGGGG - Intergenic
1154356794 18:13627746-13627768 GCTTATAGCCAGAGGGACAGAGG + Intronic
1155543240 18:26887940-26887962 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1155614110 18:27701578-27701600 CGTTCTAGGCAGAGAGAAAGTGG + Intergenic
1155753374 18:29457710-29457732 ACAACTATCCAGAGGAAAAGGGG - Intergenic
1156813188 18:41276365-41276387 CCTTCAATCCAAAAAGAAAGGGG - Intergenic
1158114692 18:53982232-53982254 GCTTCTCTCCTGAGGGAAATTGG - Intergenic
1159752694 18:72322586-72322608 TCTAATATCCAGAAGGAAAGTGG + Intergenic
1160389084 18:78517028-78517050 CCTTTTATCCTGGAGGAAAGAGG + Intergenic
1160758581 19:771476-771498 GCTTCTACCCAGAGGGAAATGGG - Intergenic
1160855388 19:1214977-1214999 CCTTCTATTCAGAGGAGATGCGG - Intronic
1161346215 19:3770029-3770051 CATTCTATAGAGAGGGAAACCGG - Exonic
1163214182 19:15863711-15863733 GCTTCTGTCCAGAGGTAAGGCGG - Intergenic
1166237040 19:41464246-41464268 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1166237073 19:41464396-41464418 CTTAATATCCAGAAGGAAAGAGG - Intergenic
1166237791 19:41469065-41469087 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1166242235 19:41502278-41502300 CCTAATATCCAGTGGGGAAGAGG - Intergenic
1166243955 19:41512622-41512644 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244681 19:41517059-41517081 CCTAATATCCAGGGGGAAAGAGG - Intergenic
1166244715 19:41517209-41517231 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166245157 19:41519902-41519924 CCTAATATCCAGGGGTAAAGAGG - Intergenic
1167299983 19:48672639-48672661 GCAACTATCCAGAGAGAAAGGGG - Intronic
1168397953 19:56065024-56065046 ACTTCTATCCAAACGGAATGTGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925607964 2:5678383-5678405 TCTTGTAACCAGAGGGCAAGGGG - Intergenic
926959996 2:18346215-18346237 AATTCTATCCAGAGAGATAGGGG + Intronic
927006370 2:18853599-18853621 CCTTCTATCCAGAGGTTGAATGG + Intergenic
927919530 2:26961328-26961350 CATTCAATCCAGAGGGAAAAGGG + Intergenic
931791262 2:65666234-65666256 CCTTCCATCCAGTGGGAAAGCGG - Intergenic
931902433 2:66804601-66804623 CCATCTGTCCAGGGGGAAGGGGG + Intergenic
932350199 2:71025185-71025207 CCTAATATCCAGGGGGGAAGAGG - Intergenic
932350268 2:71025564-71025586 CCTAATATCCAGAGCGAAAGAGG - Intergenic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932353687 2:71051318-71051340 CCTAATATCCAGGGGGGAAGAGG - Intergenic
932353767 2:71051771-71051793 CCTAATATCCACAGGGAGAGAGG - Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
932892713 2:75610590-75610612 CCTTCTCTCCAGCTGGAAGGAGG + Intergenic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
933456512 2:82526035-82526057 CCTAATATCCAGTGGGAAAGAGG - Intergenic
933456606 2:82526600-82526622 CCTTGTATCGAGAGGGGGAGAGG - Intergenic
934591040 2:95550463-95550485 CCTAATATCCAGGGGGAAAGAGG - Intergenic
935331143 2:101978920-101978942 CCTCCTCTTCAGAGGGAAAGGGG - Intergenic
935548173 2:104423067-104423089 CCTCCTATCCAGTGGCAATGTGG - Intergenic
935609543 2:105006716-105006738 ACTGCAATCCAGAGGGACAGAGG - Intergenic
935997266 2:108787429-108787451 ATTTCTATTCAGAGGTAAAGGGG - Intronic
937303880 2:120859348-120859370 CCTTCCTTCAAGAGGGGAAGGGG - Intronic
940717524 2:157244546-157244568 CCTTATATCTAGAGGGCATGGGG + Intergenic
940869753 2:158849958-158849980 CCTAATATCCAGGGGGGAAGAGG - Intronic
940871640 2:158865521-158865543 CCTAATATCCAGAGGGGGAGAGG - Intergenic
940872439 2:158870957-158870979 CCTAATATCCAGGGGGGAAGAGG - Intergenic
940872504 2:158871336-158871358 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940872514 2:158871411-158871433 CCTAATATCCACAGGGAGAGAGG - Intergenic
940872528 2:158871486-158871508 CCTAATATCCAGAGGGAGAGAGG - Intergenic
940873723 2:158881052-158881074 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940873734 2:158881127-158881149 CCTAATATCCACAGGGAGAGAGG - Intergenic
940873750 2:158881202-158881224 CCTACTATCCAGAGGGAGAGAGG - Intergenic
940874701 2:158887320-158887342 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940874711 2:158887395-158887417 CCTAATATCCACAGGGAGAGAGG - Intergenic
940874726 2:158887470-158887492 CCTAATACCCAGAGGGAGAGAGG - Intergenic
941533173 2:166693820-166693842 CCTAATATCCAGAGGGAGAGAGG - Intergenic
942317007 2:174706130-174706152 CCTAATATACAGGGGGAAAGAGG - Intergenic
942317253 2:174707643-174707665 CATAATATCCAGAGGGAAAGAGG - Intergenic
942317685 2:174710131-174710153 CCTAATATCCAGAGGGGAAGAGG - Intergenic
943842540 2:192600492-192600514 CCTAATATCCAGGGGGCAAGAGG + Intergenic
945393616 2:209295388-209295410 GTATCTATCCAGAGGAAAAGAGG + Intergenic
946793528 2:223325697-223325719 CTTTCTCTTGAGAGGGAAAGAGG + Intergenic
947721563 2:232372607-232372629 CCTTCCATCCAGAGGCAAGAAGG - Intergenic
948032964 2:234834669-234834691 TCTTCTATCCTGAGGGAAGCTGG - Intergenic
948600389 2:239104600-239104622 CCGTCTGTCCAGAGGGAACTTGG - Intronic
948720783 2:239898871-239898893 CCTTCTCTCCACATGTAAAGGGG + Intronic
1168810926 20:704111-704133 CATTCCAGCCAGAGGGAAAGAGG + Intergenic
1169740182 20:8884932-8884954 CCTTCTTTTGACAGGGAAAGTGG + Intronic
1170763863 20:19274041-19274063 CCTTTAACCCAGAGGGGAAGAGG - Intronic
1171207363 20:23291280-23291302 CCGTCTACCAGGAGGGAAAGGGG - Intergenic
1171894607 20:30748263-30748285 TGTAGTATCCAGAGGGAAAGAGG + Intergenic
1172176782 20:32977325-32977347 CCCTGGATCCACAGGGAAAGAGG - Intergenic
1173723955 20:45283939-45283961 GCTGCTTTCCAGAGGGCAAGAGG - Intergenic
1174321230 20:49743196-49743218 CCAACAATCCAGAGGGAAAGAGG - Intergenic
1174374179 20:50114491-50114513 TATTTTATCCAGAGGGAATGGGG - Intronic
1175469975 20:59220625-59220647 CCTTTTAATCAGAGAGAAAGAGG + Intronic
1179472335 21:41620066-41620088 ACTTGTCTCCAGAGGGAAGGAGG + Intergenic
1179671758 21:42954316-42954338 CCTAATATCCAGAGCCAAAGAGG + Intergenic
1179671829 21:42954695-42954717 CCTCATATCCAGGGGGGAAGAGG + Intergenic
1179707922 21:43193040-43193062 CTTACTTTCCAGAGGGCAAGAGG + Intergenic
1180869781 22:19139604-19139626 TGTACTATCCAGAGGGTAAGTGG - Exonic
1182420196 22:30245268-30245290 CCTTCCAGCCAGAGGGCCAGGGG - Intronic
1183035210 22:35135925-35135947 CCTTCCATCCAGTGGATAAGTGG - Intergenic
1183116782 22:35698301-35698323 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1183117370 22:35702285-35702307 CCTAATATCCAGCGGGAAAGAGG - Intergenic
1184637327 22:45843885-45843907 CGTTCTATCCAGGGGGACAAAGG - Exonic
1184696216 22:46140535-46140557 GCTTGTTTTCAGAGGGAAAGGGG - Intergenic
949882439 3:8672399-8672421 CCTACTATCCAGAAGAAAAGAGG - Intronic
949884883 3:8684904-8684926 CCTAATATCCAGAGCGAAAGAGG - Intronic
949884894 3:8684979-8685001 CCTAATATCCACAGGGAGAGAGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
950197319 3:11018025-11018047 CGCTCTCTCCAGAGGGCAAGAGG - Intronic
950414320 3:12860019-12860041 TCTTCTGTCCTGGGGGAAAGGGG - Intronic
950790848 3:15470606-15470628 CCTTCTTTCCAGGGTGAAATGGG - Exonic
952990169 3:38824602-38824624 GGTTGTATCCATAGGGAAAGAGG + Intergenic
954178011 3:48859554-48859576 TCTTCACTCCGGAGGGAAAGAGG - Exonic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957044068 3:75360690-75360712 CCTAATATCCACAGGGAGAGAGG + Intergenic
957044077 3:75360765-75360787 CCTAATATCCAGAGTGAAAGAGG + Intergenic
957044143 3:75361144-75361166 CCTAATATCCAGATGGGAAGAGG + Intergenic
957075861 3:75602871-75602893 CCTAATATCCACAGGGAGAGAGG + Intergenic
957075870 3:75602946-75602968 CCTAATATCCAGAGCGAAAGAGG + Intergenic
957075937 3:75603325-75603347 CCTAATATCCAGGGGGGAAGAGG + Intergenic
958133359 3:89457675-89457697 GCTTTTATCCATAAGGAAAGGGG + Intronic
959982197 3:112528848-112528870 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982267 3:112529240-112529262 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982281 3:112529315-112529337 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982354 3:112529769-112529791 CCTAATATCCAGGGGGGAAGAGG + Intergenic
961217624 3:125172694-125172716 ACTTCTTTCCAGAGGGAGATTGG - Intronic
961272560 3:125699999-125700021 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961275359 3:125721857-125721879 CCTAATATCCAGGGGGGAAGAGG - Intergenic
961275422 3:125722237-125722259 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961278332 3:125744858-125744880 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961278339 3:125744933-125744955 CCTAATATCCACAGGGAGAGAGG - Intergenic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961642813 3:128375516-128375538 CCTGCGGTCCAGAGGGACAGAGG - Intronic
961742591 3:129042106-129042128 CCTTTTACCCATAGGTAAAGAGG - Intergenic
961876055 3:130024723-130024745 CCTAATATCCACAGGGAGAGAGG + Intergenic
961876066 3:130024798-130024820 CCTAATATCCAGAGTGAAAGAGG + Intergenic
961876134 3:130025178-130025200 CCTAATATCCAGGGGGGAAGAGG + Intergenic
962025582 3:131543918-131543940 CCAGCTTTCCAGATGGAAAGGGG - Intronic
964888954 3:161515891-161515913 CCTAATATCCAGAGGGGGAGAGG - Intergenic
964889071 3:161516594-161516616 TCTGATATCCAGAGGGGAAGAGG - Intergenic
965537341 3:169836940-169836962 GCTTCTATTCAGAGAGAAATGGG + Intronic
967183564 3:186927411-186927433 GATACTGTCCAGAGGGAAAGTGG + Intergenic
968294241 3:197561393-197561415 CCTTCTATCGTCATGGAAAGAGG - Intronic
968988428 4:3892543-3892565 CCTAATATCCAGAGCGAAAGAGG + Intergenic
968988495 4:3892923-3892945 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969019422 4:4129844-4129866 CCTAATATCCAGAGCGAAAGAGG + Intergenic
969019487 4:4130222-4130244 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969020559 4:4137477-4137499 CCTAGTATCCCGAGGGAGAGAGG + Intergenic
969024030 4:4159572-4159594 CCTAATATCCACAGGGAGAGAGG + Intergenic
969024041 4:4159647-4159669 CCTAACATCCAGAGCGAAAGAGG + Intergenic
969024103 4:4160027-4160049 CCTAATATCCAGGGGGGAAGAGG + Intergenic
969025008 4:4166059-4166081 CCTAATATCCACAGGGAGAGAGG + Intergenic
969025021 4:4166134-4166156 CCTAATATCCCGAGCGAAAGAGG + Intergenic
969025086 4:4166512-4166534 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969729720 4:8947117-8947139 CCTAATATCCAGGGGGGAAGAGG - Intergenic
969729791 4:8947497-8947519 CCTAACATCCAGAGCGAAAGAGG - Intergenic
969733273 4:8969859-8969881 CCTAGTATCCCGAGGGAGAGAGG - Intergenic
969734535 4:8978173-8978195 CCTCATATCCAGAGCGAAAGAGG - Intergenic
969734547 4:8978249-8978271 CCTAATATCCACAGGGAGAGAGG - Intergenic
969734563 4:8978324-8978346 CCTCGTATCCAGAGGGCGAGAGG - Intergenic
969785958 4:9457124-9457146 CCTAATATCCACAGGGAGAGAGG - Intergenic
969789374 4:9481455-9481477 CCTAATATCCAGAGCGAAAGAGG - Intergenic
969792863 4:9503935-9503957 CCTAGTATCCCGAGGGAGAGAGG - Intergenic
969792968 4:9504912-9504934 CCTAATATCCAGGGGGAGAGAGG + Intergenic
975702252 4:77077243-77077265 CCTTTTATACACAGGGATAGAGG - Intergenic
977479734 4:97560543-97560565 CCTTCAATCCAGTGTTAAAGAGG - Intronic
978358995 4:107908197-107908219 CTTTCTTTCCAGTGGGAAAGTGG + Intronic
978453174 4:108859349-108859371 CCTTCCTTGCAGAGGGAATGTGG - Intronic
978808372 4:112824183-112824205 CCGTCTATCTAGAGGGAGACAGG + Intronic
979438390 4:120721972-120721994 CCGTCTTTGCAGAGGGACAGAGG + Intronic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980666902 4:135952230-135952252 CCTCATTTCCAGAGGAAAAGTGG + Intergenic
981316443 4:143344305-143344327 CCCTCCATCCACAGGGAGAGGGG - Intronic
984723949 4:183002171-183002193 CCTTGTAGCCAGAGGTAAAGAGG - Intergenic
985475761 5:78230-78252 ACTTTTGTCCAGAGGCAAAGAGG + Intergenic
985828137 5:2207905-2207927 CCTTCTTTCCAGAGTGAACTTGG + Intergenic
986636717 5:9829629-9829651 CCTCCTTTCCAGCAGGAAAGCGG - Intergenic
989987309 5:50716147-50716169 CCTTCTATGGAGAAGGGAAGAGG + Intronic
991944785 5:71889570-71889592 CCATCTTCCCAGAGTGAAAGTGG - Intergenic
993781490 5:92071115-92071137 CATTCTATCCATAGGCAAAGTGG + Intergenic
994393334 5:99209322-99209344 CCTAATATCCAGAAGAAAAGTGG - Intergenic
994393423 5:99209942-99209964 CCTAATATTCAGGGGGAAAGAGG - Intergenic
994394051 5:99214057-99214079 CCTAATATCCAGGTGGAAAGAGG - Intergenic
994394097 5:99214357-99214379 CCTAATATCCAGGGGGAAAGAGG - Intergenic
994394201 5:99215031-99215053 CCTAATATCCAGAAGAAAAGAGG - Intergenic
994394989 5:99220076-99220098 CCTAACATCCAGAGGGGAAGAGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
994396336 5:99228502-99228524 CCTAATATCCAGGGGGAAAGAGG - Intergenic
995051295 5:107707548-107707570 CCTACTATCAAGAGATAAAGCGG - Intergenic
997422175 5:133778465-133778487 CTTTCTTTGCAGAGGCAAAGTGG + Intergenic
997449239 5:133968437-133968459 CGCTCTATCCAGTGGTAAAGGGG - Exonic
997685073 5:135782819-135782841 CCTAATATCCAGAGGGGAAGAGG + Intergenic
997685279 5:135784212-135784234 TCTTCTATCCAGGGAGAAAGAGG + Intergenic
997687203 5:135796775-135796797 CCTAATATCCAGGGGGAAAAAGG + Intergenic
997687414 5:135798267-135798289 TCTAATATCCAGGGGGAAAGAGG + Intergenic
998452575 5:142246174-142246196 CCTCCTTTCCAGAGGGGAAAGGG + Intergenic
998936209 5:147233388-147233410 CCTAATATCCAGCGGGAAAGAGG + Intergenic
999103900 5:149052034-149052056 CTTTTCATCAAGAGGGAAAGAGG + Intronic
1000267284 5:159649701-159649723 CCTTCTATTCATAGAGTAAGGGG + Intergenic
1001420080 5:171579458-171579480 ACAGCTATCCAGAGGGAAACAGG + Intergenic
1001553943 5:172623653-172623675 ACTTCTATCCACAGAGCAAGGGG + Intergenic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1002074937 5:176702869-176702891 TCTTCATTCCAGAGGGCAAGCGG - Intergenic
1002174886 5:177396339-177396361 CCTTCAATCCAGGAGCAAAGAGG + Intronic
1005152928 6:22773135-22773157 CCTTCTACCTAAAGAGAAAGAGG - Intergenic
1005498904 6:26412968-26412990 TCTTGTGTCCAGAGGGGAAGAGG - Intronic
1005914848 6:30343033-30343055 GCTCCTCTCCAGAGGCAAAGTGG + Exonic
1006414528 6:33895618-33895640 CCTTCTGCCCAGAGGGAATTTGG - Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1009046517 6:58242171-58242193 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009046616 6:58242776-58242798 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009048198 6:58252292-58252314 CATAATATCCAGAGGGAAAGAGG + Intergenic
1009049762 6:58262386-58262408 CCTGATATCCAGGGGGGAAGAGG - Intergenic
1009049800 6:58262689-58262711 TCTAATATTCAGAGGGAAAGAGG - Intergenic
1009049816 6:58262827-58262849 CCTAATATCCAGAGAGAAAGAGG - Intergenic
1009049836 6:58262978-58263000 CCTAATATCCAAATGGAAAGAGG - Intergenic
1009222172 6:60995503-60995525 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1009222332 6:60996487-60996509 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009222388 6:60996864-60996886 CATAATATTCAGAGGGAAAGAGG + Intergenic
1009222426 6:60997088-60997110 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009224074 6:61007072-61007094 CATAATATCGAGAGGGAAAGAGG + Intergenic
1009225306 6:61015632-61015654 CCTGATATCCAGGGGGGAAGAGG - Intergenic
1009225365 6:61016086-61016108 CCTAATATCCAGAGAGAAAGAGG - Intergenic
1009225385 6:61016237-61016259 CCTAATATCCAAATGGAAAGAGG - Intergenic
1009225734 6:61018799-61018821 CGTAATATCCAGAGGGGAAGAGG - Intergenic
1009227189 6:61030536-61030558 CCTAATATCCAGAGGGGAAGAGG - Intergenic
1009227454 6:61032188-61032210 ACTAATATCCAGGGGGAAAGAGG - Intergenic
1009228798 6:61040262-61040284 CCTAATATCCAGAGTGAAAGAGG - Intergenic
1009362961 6:62836974-62836996 GCTAATATCCAGAGGGAAAGAGG + Intergenic
1009363054 6:62837652-62837674 CCTAATAACCAGGGGGAAAGAGG + Intergenic
1009363265 6:62839015-62839037 CCTAATATCCAGAGGGCAAGAGG + Intergenic
1009364476 6:62847409-62847431 CCTGATATCCAGAAGGAAAGAGG - Intergenic
1009364993 6:62851007-62851029 CCTAATATCCAGAGAGGAAGAGG + Intergenic
1009365220 6:62852687-62852709 CCTAGTATCCAGGGGGAGAGAGG + Intergenic
1009365511 6:62854792-62854814 CCTAATATCCAGACGGAGAGAGG + Intergenic
1009365990 6:62858232-62858254 TCTAATATTCAGAGGGAAAGAGG + Intergenic
1009367999 6:62870520-62870542 CCTAATATCCAGATGGAAAGAGG + Intergenic
1009368042 6:62870895-62870917 CCTAATATCAAGGGGGAAAGAGG + Intergenic
1009368055 6:62871040-62871062 CCTAATATCCAGGAGGAAAGAGG + Intergenic
1009368081 6:62871264-62871286 CTTAATATCCAGAAGGAAAGAGG + Intergenic
1009368224 6:62872393-62872415 CCTAGTATCCAGAGTGGAAGAGG + Intergenic
1009369142 6:62879472-62879494 TCTTATATCCAGTTGGAAAGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1009923499 6:70092300-70092322 CCTCCACTCCAGAGGGAAACTGG + Intronic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1012773839 6:103478937-103478959 CCTAATATCCAAAAGGAAAGAGG + Intergenic
1012774072 6:103480479-103480501 TCTAATATCCAGAGGAAAAGAGG + Intergenic
1012774120 6:103480795-103480817 CCTTATATCCAGGTGGAGAGAGG - Intergenic
1013633679 6:112008996-112009018 CCATCTATCCTGAGAGACAGAGG - Intergenic
1014886229 6:126784791-126784813 CATTTTATCCAGTGGGAAAAAGG + Intergenic
1017402836 6:154084022-154084044 ATTTCCATCCAGAGGGCAAGTGG - Intronic
1017950190 6:159129640-159129662 CCATGAATCCAGAGGGAAATGGG - Intergenic
1019706763 7:2500489-2500511 CCTTCTCTCCTCAGGGAGAGGGG - Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020306696 7:6841186-6841208 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020306707 7:6841261-6841283 CCTCATATCCAGAGCGAAAGAGG + Intergenic
1020306779 7:6841640-6841662 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1020311153 7:6869814-6869836 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020311198 7:6870116-6870138 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1020311259 7:6870496-6870518 CCTAATACCCAGGGGGAAAGAGG + Intergenic
1020336209 7:7064221-7064243 CCTGATATCCAGCGGGAAAGCGG + Intergenic
1021270497 7:18578466-18578488 CCTTCTCTGCAGAGGGTTAGAGG + Intronic
1027555345 7:79657604-79657626 GCTTCTATTAACAGGGAAAGTGG + Intergenic
1028205572 7:88012960-88012982 CCTTGGCTCTAGAGGGAAAGAGG - Intronic
1028773148 7:94650268-94650290 CCTCTTCTCCAGAGGGAAATAGG - Intronic
1028865569 7:95707437-95707459 CCTACTAGCCAGAGGGGATGAGG + Intergenic
1029077836 7:97950058-97950080 CCTCATATCCAGAGGGCGAGAGG + Intergenic
1029077849 7:97950133-97950155 CCTAATATCCACAGGGAGAGAGG + Intergenic
1029077862 7:97950208-97950230 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1029077932 7:97950586-97950608 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1029301319 7:99584117-99584139 CCTAATATCCAGAGAGAGAGAGG - Intronic
1029301357 7:99584334-99584356 CCTAGTATCCAGAGGGGGAGAGG - Intronic
1029301500 7:99585317-99585339 CCTACTATCCAGTAGGGAAGAGG - Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1029301665 7:99586351-99586373 CCTAATATCCATGGGGAAAGTGG - Intronic
1029342565 7:99956929-99956951 CCTAATCTCCAGAGGGGAAGAGG + Intergenic
1029611965 7:101631201-101631223 CCATCTACACAGGGGGAAAGGGG - Intergenic
1032231050 7:130074576-130074598 CCATCTATCCAGAGTCAATGTGG - Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1034168846 7:149047105-149047127 TTTTCTATCCAGTAGGAAAGAGG + Intergenic
1036239173 8:7068143-7068165 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1036240067 8:7073919-7073941 CCTAATATCCAGGGGGAAACAGG - Intergenic
1036240134 8:7074298-7074320 CCTAAAATCCAGAGTGAAAGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036240172 8:7074523-7074545 CCTACTATCCAGAGGGCGACAGG - Intergenic
1036240237 8:7074847-7074869 CCTAATATCCAGAGGGCCAGAGG - Intergenic
1036817635 8:11913794-11913816 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036819856 8:11931835-11931857 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036819867 8:11931910-11931932 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036819933 8:11932289-11932311 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1036820720 8:11937246-11937268 CCTAATATCCATGGGGAAAGGGG + Intergenic
1036833042 8:12036861-12036883 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036903184 8:12687207-12687229 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036903193 8:12687282-12687304 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036905667 8:12706796-12706818 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1036905680 8:12706871-12706893 CCTAATATCCACAGGGAAAGAGG + Intergenic
1036905690 8:12706946-12706968 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036906646 8:12713064-12713086 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036972111 8:13366784-13366806 CCTTCGACCCAGAGGGGAAAGGG - Intronic
1039767554 8:40646772-40646794 CGTTCTATCCATATTGAAAGTGG - Intronic
1041800093 8:61789414-61789436 CCATCTATACAGACTGAAAGAGG - Intergenic
1043633589 8:82365785-82365807 CCTAATATCCGGTGGGAAAGAGG + Intergenic
1043635081 8:82375162-82375184 CTTACTATCCAGAAGGAAAGAGG + Intergenic
1043635482 8:82377535-82377557 CCTAATATCCAGGGGGAAAAAGG + Intergenic
1044500754 8:92952760-92952782 CCTTCTATCCAGAGGGAAAGGGG - Intronic
1044871215 8:96621697-96621719 TCTTCTATCTAGAGGGACACTGG + Intergenic
1045923922 8:107565700-107565722 CATAATATCCAGTGGGAAAGAGG + Intergenic
1045924564 8:107569870-107569892 CCTAATATCCAGTGGAAAAGAGG + Intergenic
1045924850 8:107571729-107571751 CCTTATAACCAGGGGGAGAGAGG + Intergenic
1045924880 8:107571878-107571900 CCTTATATCCAGTGGGGGAGTGG + Intergenic
1045925749 8:107577616-107577638 CCTAATATTCAGAAGGAAAGAGG + Intergenic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1045926326 8:107581664-107581686 CCTAATATCCAGAGGAAAAGAGG + Intergenic
1045927387 8:107588659-107588681 CATAATATCCAGGGGGAAAGAGG + Intergenic
1045927500 8:107589452-107589474 CATTATATCCGGTGGGAAAGAGG + Intergenic
1046916352 8:119681868-119681890 ACCTCTATCCAAAGGGAAATAGG - Intergenic
1047515867 8:125554483-125554505 CTTTCTAAGCAGAGAGAAAGAGG + Intergenic
1048040092 8:130718910-130718932 GCATCTACCCAGAGGAAAAGAGG + Intergenic
1048875940 8:138837243-138837265 CCTTATAACCAGAGTGAAAGAGG - Intronic
1050341973 9:4649214-4649236 CTGTCTACCCAGAGGAAAAGAGG - Intronic
1050902644 9:10966248-10966270 CCTAATATCCAGGGGGCAAGAGG + Intergenic
1052236595 9:26218548-26218570 TATTCTATCTAGAGGGAAAGAGG + Intergenic
1052690332 9:31808805-31808827 CTTTCTTTCCTGAGGGTAAGAGG - Intergenic
1053738185 9:41115263-41115285 CCTAATATCCAGGGGGCAAGAGG + Intergenic
1054689981 9:68315039-68315061 CCTTATATCCAGGGGAAGAGAGG - Intergenic
1054690165 9:68316055-68316077 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1056865272 9:90222983-90223005 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1056866093 9:90228417-90228439 CCTAATATCCAGGGGGGAAGAGG - Intergenic
1056866161 9:90228791-90228813 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1056866173 9:90228866-90228888 CCTAATATCCACAGGGAGAGAGG - Intergenic
1056866187 9:90228941-90228963 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1056916840 9:90753968-90753990 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1056916865 9:90754118-90754140 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1056916935 9:90754492-90754514 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1057043476 9:91864884-91864906 CCTTCTCTCTGAAGGGAAAGGGG + Intronic
1058340137 9:103885580-103885602 CTTTCTATCCAGACAGAATGGGG - Intergenic
1058519085 9:105801702-105801724 CCTAATATCCAGAAGGGAAGAGG - Intergenic
1058520106 9:105808265-105808287 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1058520598 9:105811343-105811365 CCTAATATCCAAAGGTAAAGAGG + Intergenic
1058521083 9:105814752-105814774 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521542 9:105817969-105817991 CCTTATATCGAGAGGGGGAGAGG + Intergenic
1058521638 9:105818540-105818562 CCTAATATCCAGTGGGAAAGAGG + Intergenic
1058932824 9:109738626-109738648 TCTTCTATCCAGAAGAAAAAGGG + Intronic
1059018849 9:110551931-110551953 CCAGATATCCAGATGGAAAGAGG - Intronic
1059537636 9:115097428-115097450 CCTTGTATCCAGAAGGGATGGGG + Intronic
1060016793 9:120093589-120093611 CCTTGTATGGAGAGAGAAAGGGG + Intergenic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1188399727 X:29729845-29729867 CCCTCTATCCAAACGGAAAGTGG + Intronic
1192147587 X:68692275-68692297 CCTGCCATCAAGAGGAAAAGAGG + Intronic
1193446519 X:81611569-81611591 GTATCTATCCAGAGGAAAAGAGG - Intergenic
1193565258 X:83067951-83067973 CCTTTTAGCCAGAGAAAAAGGGG + Intergenic
1200051852 X:153437018-153437040 CCTTGTATGCAGGGAGAAAGAGG + Intergenic
1202057566 Y:20850908-20850930 CCTTCTCTCAAGTGGAAAAGTGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic