ID: 1044501242

View in Genome Browser
Species Human (GRCh38)
Location 8:92960776-92960798
Sequence CTGAAATCAAGGTCGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044501242 Original CRISPR CTGAAATCAAGGTCGGGACA GGG (reversed) Intronic
900282026 1:1876118-1876140 CTGAAATCAAGGTGTTGGCAGGG - Intronic
900480862 1:2898520-2898542 CCAAAATCAAGGTAGGGGCAGGG + Intergenic
900711995 1:4120209-4120231 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
900719861 1:4168634-4168656 CAGAAATCAAGGTGTGGGCAGGG + Intergenic
900746113 1:4361830-4361852 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
900760796 1:4468849-4468871 CTGAAATCAAGGTGTGGATAGGG + Intergenic
900782726 1:4628617-4628639 CTGAAAGAAAGGTCGGGTCAAGG + Intergenic
900905544 1:5554490-5554512 CCTAAATAAAGGTCGGGATAGGG + Intergenic
900950664 1:5856672-5856694 CTGAGATCAAGGTGAGGGCAGGG + Intergenic
901178948 1:7326703-7326725 CTGAAATCAAGGTGCTGGCAGGG - Intronic
901508129 1:9699543-9699565 CTGAAGTCAAGGGCGTGACTGGG - Intronic
902722100 1:18310746-18310768 CTGAAATCAAGGTGTTGGCATGG + Intronic
902753257 1:18532212-18532234 CTGAAATCAAGGTGTGTGCAGGG - Intergenic
903976286 1:27152610-27152632 GAGAAATCAAGGACTGGACAAGG - Intronic
904436588 1:30502527-30502549 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
904955414 1:34279630-34279652 CTGAAATCAAGGTGGTGGGAGGG + Intergenic
905097219 1:35483823-35483845 CTGAAATCAAGGTGTTGGCAGGG + Intronic
905119542 1:35671184-35671206 CTGAAATCAAGGTATTGGCAGGG - Intergenic
905953980 1:41976898-41976920 CTGAAATCAAGGTGTCCACAAGG - Intronic
906200234 1:43955446-43955468 CTGAAATCAAGGTGTTGGCAAGG + Intronic
906603630 1:47149798-47149820 ATGAAAACAAGTTCTGGACAGGG + Intergenic
906872968 1:49504055-49504077 CACAAATCAAGGGTGGGACAAGG + Intronic
907289124 1:53401668-53401690 CTGAAATCAAGGTGCTGTCAGGG - Intergenic
908113254 1:60917687-60917709 CTGAAATCAAGGTGTGAGCAGGG + Intronic
908333530 1:63096533-63096555 TTGAAATCAAGGTGTTGACAGGG - Intergenic
909891875 1:81017497-81017519 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
910462111 1:87458602-87458624 CTGAAATCAAGGTGTTGACAGGG - Intergenic
910988094 1:93026230-93026252 CTGAGATCAAGGTGTGGGCATGG + Intergenic
911101843 1:94101603-94101625 CTGAGATCAAGGTCTGCACAGGG - Intronic
911365642 1:96934415-96934437 CTGAAATCAAGGTGTAGGCAGGG + Intergenic
911998660 1:104800652-104800674 CTGAAGGCAATGTCTGGACAGGG - Intergenic
912094696 1:106123909-106123931 CTGAAATCAAGGTGTGGACTGGG - Intergenic
912296082 1:108472289-108472311 CAAAAACCAAGGTGGGGACAAGG - Intergenic
912464548 1:109862561-109862583 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
912561770 1:110556183-110556205 CTTAAGTCAAGCTCAGGACAAGG + Intergenic
913466745 1:119150704-119150726 CTGAAATCAAGGTGGAGGCAGGG - Intergenic
913715194 1:121526665-121526687 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
916958530 1:169865505-169865527 CTGCAATCAAGTTGGGGAGATGG - Intronic
916963684 1:169913589-169913611 CTGAAATCAAGGTATGAGCAGGG - Intergenic
917674904 1:177309743-177309765 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
918100119 1:181365655-181365677 CTGAAGCCAGGGTCTGGACAGGG + Intergenic
918316210 1:183324729-183324751 CTGAGATAAAGGGCGGCACAGGG - Intronic
918544425 1:185666128-185666150 TTGAAATCAAGGTATTGACAGGG + Intergenic
919157968 1:193791270-193791292 CTGAAATCAAGGTTTTGGCAGGG + Intergenic
920007201 1:202842074-202842096 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
920566918 1:206981501-206981523 CTGAAATCAAGGTACTGGCAAGG + Intergenic
920864298 1:209738938-209738960 CTGAAATCAAGTTGTTGACAGGG - Intergenic
921232288 1:213085097-213085119 CTGAAATCAAGGTGTTGGCAGGG + Intronic
921842004 1:219838645-219838667 CTGAATTTAAGGTGAGGACAGGG + Intronic
922017351 1:221664055-221664077 CTGAAGTCAAGGTGTTGACAGGG - Intergenic
922659814 1:227420008-227420030 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
922731713 1:227952008-227952030 CTGGAATCAATGTCGGTGCAGGG - Intergenic
922772772 1:228196878-228196900 CTGAAATCAAGGGGTGGGCAGGG + Intergenic
923144715 1:231189967-231189989 CTAAAATCAAGGTATGGGCAGGG - Intronic
924730135 1:246703638-246703660 CTGAAATCAAGTTGCGGACCAGG + Intergenic
1063386621 10:5620085-5620107 CTGAAAACAAGGACGTGCCAGGG - Intergenic
1065004034 10:21363124-21363146 CTGAAATCAAGGTACGGGCAGGG - Intergenic
1065619724 10:27568780-27568802 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1065959805 10:30725383-30725405 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1066476624 10:35753118-35753140 CTGAAATCAATGTGGGGACGTGG - Intergenic
1066554187 10:36593100-36593122 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1067726630 10:48775561-48775583 CTGAAAGCAATGTGGAGACAGGG - Intronic
1068272088 10:54741607-54741629 CTAAAATCAAGGTATTGACAGGG + Intronic
1068765528 10:60759126-60759148 CTGAAATCAAGGTAGGAGAATGG + Intergenic
1069934371 10:71905219-71905241 CTAAAATCCAGGTGTGGACAGGG - Intergenic
1070246740 10:74739314-74739336 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1071385621 10:85117368-85117390 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1071465897 10:85939422-85939444 CTAAAATCAAGGTGTTGACAGGG + Intronic
1072747940 10:97954761-97954783 CTGAAATCAAGGTATCAACAAGG + Intronic
1073600855 10:104844757-104844779 CTGAAATCAAGGTGTCGTCAGGG + Intronic
1074062924 10:109984343-109984365 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1074103733 10:110373970-110373992 CTGAAATCAAGATAGGAATAGGG + Intergenic
1074290176 10:112132452-112132474 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1074404648 10:113170360-113170382 CTGAAATCAAAGTGGTGGCAGGG + Intergenic
1074490471 10:113935170-113935192 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1075536557 10:123276558-123276580 CCAAAATCAAGGTGTGGACAGGG - Intergenic
1075955097 10:126516788-126516810 CTAAAATCAAGGTGGTGGCAGGG + Intronic
1076303079 10:129442450-129442472 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1076381886 10:130029054-130029076 CTGAAATCAAGGTGTGGGCAGGG + Intergenic
1077043050 11:532989-533011 CTGAACTCCAGGTCTGGCCAGGG + Intronic
1077289937 11:1784375-1784397 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1077878197 11:6325270-6325292 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1078550972 11:12280473-12280495 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1078587047 11:12600875-12600897 CTGAAATCAAGGTGCCTACATGG - Intergenic
1078794566 11:14579220-14579242 CTGAAATCAAGGTATTGGCAGGG + Intronic
1078916419 11:15782907-15782929 CCGAAATCAAGGTGCTGACAGGG - Intergenic
1079120990 11:17684822-17684844 CTGAAATCAGGGGCAGGCCAGGG + Intergenic
1079569883 11:21929988-21930010 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1080045706 11:27805496-27805518 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1080657402 11:34268707-34268729 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1080881261 11:36323019-36323041 CTGAAATCAAGGTGTGCACAGGG - Intronic
1080898535 11:36466292-36466314 CTGAAATCAAGGTGGTGTCAAGG + Intergenic
1081054118 11:38386806-38386828 CTGAAATCAAGGTTTTGAGAGGG + Intergenic
1081340931 11:41926632-41926654 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1082983542 11:59145515-59145537 CTGAAAACAATGTAGGGAGACGG + Exonic
1085922899 11:80980354-80980376 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1085985803 11:81786395-81786417 CTGAAATCGAGGTGACGACAGGG + Intergenic
1086195009 11:84127452-84127474 CTGAAATCAAGGTAGTGGCAAGG + Intronic
1087956036 11:104289180-104289202 CTTAAATGAAGGCCAGGACAAGG + Intergenic
1088712629 11:112522252-112522274 CTGAAATCAAGGTGCTGACAGGG - Intergenic
1089908093 11:122066155-122066177 CCGAAATCAAGGTATTGACAGGG + Intergenic
1091130796 11:133145700-133145722 CTGATTTGAAGGTGGGGACATGG + Intronic
1091269815 11:134300150-134300172 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1091891492 12:4058563-4058585 CTGAAATCAAGGTGTTGCCAGGG + Intergenic
1092027865 12:5258135-5258157 CTGAAATCAAGGTGTGTGCAGGG + Intergenic
1094412123 12:30177714-30177736 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1095158037 12:38882401-38882423 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1095476767 12:42593568-42593590 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1095569624 12:43669596-43669618 CAGAAATCAAGGTGTGGTCAGGG - Intergenic
1096035620 12:48467310-48467332 CTGAAATCAAGGTGTCGACAGGG - Intergenic
1096222005 12:49836089-49836111 CTGAAATCAAGGTGTTGGCAGGG + Exonic
1096870593 12:54589882-54589904 GTGAAATCAAGGTCTGGAAAGGG - Intergenic
1097974557 12:65670742-65670764 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1098036543 12:66308585-66308607 CTGAGATCAAGGTGTGGACAGGG + Intronic
1098909866 12:76198063-76198085 CTGAAATCAAGGTGTCTACAGGG + Intergenic
1099750892 12:86771187-86771209 CTGAGATCATGGTGGTGACAGGG - Intronic
1099829201 12:87818085-87818107 CTGAAATCAAGGTTTTGACAAGG - Intergenic
1099904706 12:88758455-88758477 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1100162244 12:91874040-91874062 CCAAAACCAAGGTCAGGACATGG + Intergenic
1100950010 12:99837260-99837282 CTAAAATCAAGGTGTGGGCAGGG - Intronic
1102568090 12:113810191-113810213 CTGAAATCCAGGTGTGGGCAGGG - Intergenic
1102747021 12:115258263-115258285 CTGAAATCATGGACAAGACAAGG - Intergenic
1102749308 12:115278346-115278368 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1102770541 12:115472251-115472273 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1102888960 12:116543304-116543326 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
1102898724 12:116619581-116619603 CTAAAATCAAGGTGTGGACAGGG - Intergenic
1103041354 12:117698130-117698152 CTGAAATCAAGGTGGGAGCAGGG - Intronic
1104074865 12:125380136-125380158 CTGAAATCAAGGTGTGGGCAGGG + Intronic
1104341903 12:127958158-127958180 CTGAAATCAAGGTATCAACAGGG - Intergenic
1104381639 12:128312715-128312737 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1104426554 12:128682809-128682831 CTGGAGTCAAGGTGTGGACAGGG + Intronic
1105029693 12:132874111-132874133 CTAAAATCCAGGTCTGAACAGGG - Intronic
1105293631 13:19070581-19070603 CTAAAATCAAGGTGTGGGCAAGG + Intergenic
1106470534 13:30050290-30050312 CTGAAATCAAGGTGTTGGCAAGG + Intergenic
1106605894 13:31228475-31228497 CTGACATCAAGGTGTGGGCAGGG + Intronic
1106882193 13:34143757-34143779 CTGAGATCAAGGTGTGGTCAGGG - Intergenic
1107153933 13:37144672-37144694 CTGAAATCAAGGCATTGACAGGG - Intergenic
1107154213 13:37147390-37147412 GTGAAATTAACGTGGGGACAGGG + Intergenic
1107500027 13:40964370-40964392 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1107658434 13:42615110-42615132 CTGAAATCAAGGTATCGGCAGGG + Intergenic
1108701212 13:52945839-52945861 CTGAAATCAAGTTGTGGGCAGGG + Intergenic
1108856131 13:54794948-54794970 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1109348396 13:61145209-61145231 CTGAAATCAAAGTGGGCACTGGG - Intergenic
1109823554 13:67688314-67688336 CTGAAATCAAGATGTTGACAAGG + Intergenic
1110535587 13:76647260-76647282 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1111654296 13:91132658-91132680 CTAAAATCAAGGTCTGGTCAAGG - Intergenic
1111700604 13:91683307-91683329 CTGAAATCAAGGTGTGGTCTGGG - Intronic
1111930100 13:94503713-94503735 CTGAAATCAAGGTATAGGCAGGG - Intergenic
1112093447 13:96107372-96107394 GTGAAAGAATGGTCGGGACAAGG + Intronic
1112555006 13:100458970-100458992 CTAAAATCAAGGTGTGGGCAGGG + Intronic
1112582196 13:100686174-100686196 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
1113014429 13:105811943-105811965 CTGAAATCAAGGTGTTGGCATGG + Intergenic
1113143421 13:107179726-107179748 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1113275798 13:108728490-108728512 CTGAAGTCAAGGTGTGGACAGGG + Intronic
1113334184 13:109362624-109362646 CTGAAATCAAGGTGTCTACAGGG + Intergenic
1114541243 14:23461116-23461138 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1115502848 14:34064673-34064695 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1116710667 14:48364164-48364186 CTGAAATCAAGGTATCAACAGGG - Intergenic
1116871273 14:50071025-50071047 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1117341029 14:54791696-54791718 CTCAAAACAAGGTGGGGACAGGG - Exonic
1117364378 14:55011034-55011056 CTGAAATCAAGGTGTCGTCATGG - Intronic
1117470322 14:56038126-56038148 CTGAAATGAAGGTCTTGGCAGGG - Intergenic
1117483759 14:56173596-56173618 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1117744239 14:58851872-58851894 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1117838792 14:59835930-59835952 CTGAAATTAAGGTGTCGACAGGG + Intronic
1118006627 14:61569237-61569259 CAGACATCAAGTTCGGGCCATGG - Intronic
1118409308 14:65461105-65461127 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1118869233 14:69727416-69727438 CTGAAATCAAGGCGTGGGCAGGG + Intronic
1119111992 14:71983496-71983518 CTGAAATCAAGGACTGGGCAGGG + Intronic
1119128472 14:72150336-72150358 CTGGAATCAAGGTGTTGACAGGG - Intronic
1119508005 14:75189556-75189578 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1120827576 14:88969507-88969529 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1120910098 14:89658564-89658586 CTGAAATCAAGGTGTGAACTGGG + Intergenic
1121555674 14:94834898-94834920 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1124166728 15:27333308-27333330 CTAAAATCAAGGTGTGGGCAGGG + Intronic
1124338386 15:28874048-28874070 CTGAGATCAAGGTGCAGACAGGG + Intergenic
1125267628 15:37901427-37901449 CTGAAATCAAGGTATTGGCAGGG + Intergenic
1126336473 15:47590819-47590841 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1126479863 15:49106120-49106142 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1126681082 15:51202747-51202769 CTGAAATCAAGGTGTCGGCATGG - Intergenic
1128879302 15:71228386-71228408 CTGAAATCAAGGTGGCAGCAGGG - Intronic
1129063398 15:72880406-72880428 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1129068815 15:72933920-72933942 CTGAAATCAAGGTGTCGTCAGGG - Intergenic
1129332002 15:74832527-74832549 CTGGATTAAAGGTCGGGAGAGGG + Intergenic
1129705141 15:77790071-77790093 CTGAAATCAAGGTGTCGGCAGGG - Intronic
1130320481 15:82837012-82837034 CTAAAATCAAGGTGTTGACAGGG + Intronic
1130877295 15:88025670-88025692 CTGAAATCAAGGTGTTGACAGGG - Intronic
1131359280 15:91775206-91775228 CTGAGATCAAGGTGAGGGCAAGG - Intergenic
1131664012 15:94550448-94550470 CAGAAATGAAGGTGGAGACAGGG - Intergenic
1133205511 16:4230968-4230990 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1133413296 16:5586210-5586232 CTGAAACCAAGGTGTGGGCAGGG - Intergenic
1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG + Intergenic
1133717801 16:8466151-8466173 CTGAAATCATGGTGTGCACAGGG + Intergenic
1134661112 16:15985307-15985329 CTGATGTCAAGGCAGGGACATGG + Intronic
1135174770 16:20218146-20218168 CAGAAATCAACGTCAGGTCAGGG - Intergenic
1136275222 16:29175807-29175829 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1138545897 16:57719366-57719388 CTGAGATCAAGGTGTGGACAGGG + Intronic
1138931827 16:61667627-61667649 CTGAAATCAAGGTGTGGGCAGGG - Intronic
1140014712 16:71170544-71170566 CTTAAATCAAGATCCAGACAAGG - Intronic
1140039632 16:71397431-71397453 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1140709380 16:77662780-77662802 CTGAAATCAAGTTGAGGATAGGG - Intergenic
1140827044 16:78716326-78716348 CTGAAATCAAGGTGTCAACAGGG - Intronic
1140909935 16:79442094-79442116 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
1140942021 16:79730787-79730809 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1140948266 16:79791527-79791549 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
1140989599 16:80196401-80196423 TTGAAATTGAGGTCGGGAAAAGG - Intergenic
1141055673 16:80811470-80811492 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1141145907 16:81529843-81529865 CTAAAATCAAGGTGTGGGCAGGG - Intronic
1141170932 16:81691199-81691221 CTGAAATCAAGGTGTGGGCAGGG + Intronic
1141525073 16:84605742-84605764 CTAAAATCCAGGTGTGGACAGGG - Intronic
1141674742 16:85511838-85511860 CTGAAATCAAGGCAGAGGCAGGG - Intergenic
1141762176 16:86035862-86035884 CTGCAATCAAGGTGTGGGCAGGG - Intergenic
1141788733 16:86218647-86218669 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
1142079583 16:88141875-88141897 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1142975169 17:3639086-3639108 CTGAAATCAGAGTGGGAACAGGG + Intronic
1143217110 17:5233341-5233363 CTTAAAGCAAGGAAGGGACAGGG - Intronic
1143253854 17:5541604-5541626 GTGAATGCAAGGTGGGGACAGGG - Intronic
1143367009 17:6415008-6415030 CTGAAATCAAGGTGTCGCCAGGG - Intronic
1143832823 17:9665945-9665967 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1143885988 17:10065399-10065421 CTGAAATCAAGGTATTGATAGGG + Intronic
1145096232 17:20030051-20030073 CTGCAATCAAGGTGAGTACAGGG - Intronic
1145210062 17:21006080-21006102 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1146924847 17:36737026-36737048 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1148223291 17:45880426-45880448 CTAAAATCAAGGTGTCGACAGGG + Intergenic
1148231512 17:45938209-45938231 CTGAAATCAAGGTTTTGGCAAGG + Intronic
1148766047 17:50038769-50038791 TTGAAATCAAGTTCTGGACAAGG - Intergenic
1148957218 17:51363807-51363829 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1148969254 17:51464903-51464925 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1149281927 17:55114862-55114884 CTGAAATCAAGGTTGGCTCTGGG - Intronic
1149445850 17:56712746-56712768 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1150206703 17:63414460-63414482 GTAAAATCAAGGTTGGGCCAGGG - Intronic
1150932895 17:69604277-69604299 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1150997432 17:70334801-70334823 CTGAAGTCAAATTCAGGACATGG - Intergenic
1151249019 17:72819362-72819384 CTGAAATCAAGGTGGCCACAGGG - Intronic
1151432372 17:74072232-74072254 CTGAAATCAAGGTGTGGTCCGGG + Intergenic
1151517241 17:74604551-74604573 CTGAAATCAAGGTGTTAACAGGG + Intergenic
1151721975 17:75862253-75862275 CTGGAATCAAGGTACGGGCAGGG - Intergenic
1151875135 17:76863681-76863703 CTGAAATCAAGGTGTTGATACGG - Intergenic
1152292574 17:79448600-79448622 CTGAAATCAAGGTGTGGGCAGGG - Intronic
1153732939 18:8033865-8033887 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1153885526 18:9461303-9461325 CTGAGATCAAGGTGTTGACAGGG - Intergenic
1154945658 18:21159098-21159120 TTGAAATCAAGGTGTGGCCAGGG - Intergenic
1155185932 18:23386477-23386499 TTGAAATCAAGGTGTGGGCAGGG - Intronic
1155305411 18:24473389-24473411 TTGAAATCAAGGTGCTGACAGGG + Intronic
1155621308 18:27783792-27783814 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1156455812 18:37293252-37293274 CAGAAATCAAGGTTTGGACAGGG + Intronic
1156973097 18:43181885-43181907 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1158272235 18:55729009-55729031 CTGAAATCAAGGTGCCAACAGGG - Intergenic
1158799540 18:60890148-60890170 CTGAAATCAAGGTGTTGAGATGG + Intergenic
1158803737 18:60945127-60945149 CTGAAATCAAGGTGTTGTCAGGG + Intergenic
1158808149 18:60999786-60999808 CTGAAATCAAGATGGCAACATGG + Intergenic
1159603740 18:70453169-70453191 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1160083224 18:75750987-75751009 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1160236434 18:77089566-77089588 CTGACATCAAGGTGTGGGCAGGG - Intronic
1160385594 18:78494438-78494460 CTGAGACCAAGGTTGGGACTTGG + Intergenic
1160961685 19:1724939-1724961 TTGAAATCAAGGTGTGGGCAGGG - Intergenic
1161172945 19:2822381-2822403 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1161878610 19:6931415-6931437 CTGAAATCAAGGTATTGGCAGGG + Intronic
1162064040 19:8114171-8114193 CTGAAATCAAGGTGTCTACAGGG - Intronic
1162363824 19:10235993-10236015 CTGAAATCGAGCTCAGGAAAAGG - Intergenic
1163723454 19:18909349-18909371 CTGAAGTCAAGGTGGCGGCAGGG + Intronic
1164484893 19:28646814-28646836 CTGAGATCAAGGTGTTGACAGGG - Intergenic
1164525798 19:29012637-29012659 CTGAGATCAAGGTCTTGGCAGGG + Intergenic
1165704673 19:37967054-37967076 CTGAGATCAAGGTCTGGGCTCGG + Intronic
1165747191 19:38236842-38236864 CTGAAAGCAAGGTGTGGGCAGGG + Intergenic
1166816865 19:45551569-45551591 CTGAAACCAAGGTGCTGACAGGG - Intronic
1167572420 19:50297321-50297343 CTGAAATCAAGGTGTGGGCAGGG + Intronic
1167850857 19:52200640-52200662 CTGAAATCAAGGTCTCGGCAGGG + Intronic
1168025316 19:53639574-53639596 TTGAAATCAAGGTTGGGGGATGG - Intergenic
1168201557 19:54819104-54819126 CTGAAATCAAGGTGTCTACAGGG - Intronic
925790069 2:7475613-7475635 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
925920554 2:8634872-8634894 CTGAAATCAAGGTGTGGGCAAGG + Intergenic
926061018 2:9804922-9804944 CTGAAATCAAGGTGTCAACAGGG - Intergenic
926653466 2:15371699-15371721 CTGAAATAATGATGGGGACAAGG - Intronic
926699843 2:15796341-15796363 CTGAGATCCAGGAGGGGACAGGG + Intergenic
926997077 2:18747321-18747343 CAAAAAACAAGGTCGGGGCAGGG + Intergenic
927420635 2:22926865-22926887 CTAAAATCAAGGTCAGGGTAGGG + Intergenic
927756635 2:25713736-25713758 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
928428359 2:31197902-31197924 CTGAAATCAAGGTGTGAGCAGGG - Intronic
929180323 2:39031054-39031076 CTGAAATCAGGGTGTGGGCAGGG - Intronic
929443216 2:41982447-41982469 CTGAAATCAATGTGTCGACAGGG - Intergenic
929921771 2:46177408-46177430 CTGAAATCAAGGTGTTGGCAGGG + Intronic
930397265 2:50838793-50838815 CTGAAATCATGGTACTGACAGGG - Intronic
931071729 2:58659145-58659167 CTGAAATCAAGGTGTTGGCATGG + Intergenic
931443866 2:62310283-62310305 CAGAAATCAAGGTGGTGGCAGGG + Intergenic
931708288 2:64966201-64966223 CTAAAATCAAGGTGTGGGCAGGG + Intergenic
931957577 2:67444657-67444679 TTGACATCAAGGTGTGGACAGGG + Intergenic
932008664 2:67953671-67953693 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
932253706 2:70266387-70266409 CTAAAATCAAGGTGTGCACAAGG - Intronic
932638156 2:73411345-73411367 CTGAAATCAAGGTGTTGGCAGGG - Intronic
933217141 2:79643697-79643719 CTGAAATCAAGGTATTGATAGGG + Intronic
934054310 2:88239309-88239331 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934705593 2:96476201-96476223 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
934926703 2:98386940-98386962 CTAAAATCAAGGTGTTGACAGGG - Intronic
935124482 2:100211474-100211496 CTGTAATCAAGGGTGGGTCAGGG + Intergenic
935143121 2:100373016-100373038 CTGAAATCAAGGTGGTAGCAAGG + Intergenic
935502595 2:103859382-103859404 CTGAAATCAAGGTCTCAGCAGGG + Intergenic
935965131 2:108465314-108465336 CTGAGATCAAGGTTAGGAGAGGG - Intronic
937334281 2:121051903-121051925 CTGAAATCAAGGTGGCTGCAGGG - Intergenic
937435879 2:121880845-121880867 CTGCAATCAAGGTGGGATCAGGG + Intergenic
938717900 2:134037512-134037534 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
938725810 2:134108129-134108151 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
939408933 2:141799032-141799054 CTGAAATCAAGGTCTCGGTAGGG - Intronic
940013554 2:149080128-149080150 CTGAAATCAAGGTGATGGCAAGG + Intronic
940122800 2:150286399-150286421 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
940208427 2:151230537-151230559 CTAAAATCAAGGTATTGACAGGG - Intergenic
940688661 2:156885924-156885946 CTGAAATCAAGGTAGTGATAGGG - Intergenic
940933521 2:159465110-159465132 CTGAAATCAAGGTGTCAACAAGG + Intronic
941195792 2:162449741-162449763 CTGAAATCAAGATGTGGGCAAGG - Intronic
941333526 2:164210472-164210494 CTGAAATCAAGGTGTCCACAGGG - Intergenic
941500146 2:166263926-166263948 CTGAAATCAAGGTCTGAGCAAGG - Intronic
946171161 2:217896580-217896602 CTGAAATCAAGGTGTTGACGGGG - Intronic
946758244 2:222967830-222967852 GTGAAATGAAGGTGTGGACATGG - Intergenic
947082718 2:226416955-226416977 CTGAAATCAAGGTATTGTCAGGG + Intergenic
947222806 2:227810237-227810259 CTGAGATCAAGGACAAGACAAGG - Intergenic
947569487 2:231221111-231221133 CTGAAATCAAGGTGTTGGCAGGG + Intronic
947989818 2:234477775-234477797 CTGAAATCAAGGTGTGGTCACGG - Intergenic
948147847 2:235721617-235721639 CTGAAATCAAGGTGTTGACGGGG + Intronic
948489962 2:238306287-238306309 CTGAAGTCAAGGTGTGGTCAGGG - Intergenic
1168815360 20:733073-733095 CTGAAATCAAGGTGCTGGCAAGG - Intergenic
1168914318 20:1473926-1473948 CTGAAATCAAGGTATTGGCAGGG + Intronic
1169319000 20:4615853-4615875 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
1169768859 20:9179470-9179492 CTAAAATCAAGATGGGAACAAGG - Intronic
1170015292 20:11774486-11774508 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1170018891 20:11813759-11813781 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1170823394 20:19773041-19773063 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1171133612 20:22677467-22677489 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1171878226 20:30597978-30598000 CTAAAATCAAGGTGTGGGCAAGG + Intergenic
1172307041 20:33888242-33888264 CTGAAATCAAGGTGAGGGCCGGG + Intergenic
1172500118 20:35420018-35420040 CTGAAATCAAGGTGTTGACAGGG + Intergenic
1173827664 20:46057879-46057901 CTGCAATAAAGGTTGGGAGAAGG + Intronic
1174919234 20:54683856-54683878 GTGAAATGAAGGTAGGAACAAGG + Intergenic
1175271672 20:57738432-57738454 CTGAAATCAAGGTATTGACTGGG + Intergenic
1175455322 20:59108363-59108385 CTGAAATCAAGGTGTAGGCAGGG + Intergenic
1175779471 20:61673157-61673179 CTGAAGTCAAGGTGTGGGCAGGG - Intronic
1175780366 20:61678650-61678672 CTGAAATCCAGGTGTGGGCAGGG + Intronic
1176038920 20:63054270-63054292 CTGAAAGCAAGCTCTGGGCAGGG + Intergenic
1176058634 20:63161983-63162005 CTGAAATCAAGGTGTGGACAGGG - Intergenic
1176924814 21:14735274-14735296 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1177026095 21:15923503-15923525 CTGAAATCAAGGTGTTGGCAAGG - Intergenic
1177141154 21:17359597-17359619 CTGAAATCAAGTTGTTGACAGGG - Intergenic
1177388783 21:20440636-20440658 CTGAAATAAAGGTAGTGGCAGGG - Intergenic
1177422184 21:20874282-20874304 CTGAAATCAAGGTCCCAGCAGGG + Intergenic
1177788493 21:25696631-25696653 CTGAAATAAAGGTGTTGACAAGG + Intronic
1178237944 21:30864924-30864946 CTGAAATCAAAGTGTAGACAGGG - Intergenic
1179268118 21:39823735-39823757 CTAAAATCAAGGTGTGGGCAAGG - Intergenic
1179541801 21:42087798-42087820 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1179599308 21:42465488-42465510 CTGAAATCATGGTGGAGCCATGG - Intergenic
1179629776 21:42669207-42669229 CTGAAATCCAGGTGTGGGCAGGG + Intronic
1179803072 21:43820716-43820738 CTGAAACCAAGGTGTGGGCAGGG - Intergenic
1180975681 22:19846808-19846830 CTGAGATCAAGGTGTGGGCAGGG - Exonic
1181145393 22:20842304-20842326 CTGAAATCAAGGTGATGGCAGGG - Intronic
1181878346 22:25957631-25957653 CTGAAATCAAGGTGTGAACAGGG + Intronic
1182100949 22:27656806-27656828 CTGAAATCAAGGTAGCAGCATGG - Intergenic
1182275870 22:29188278-29188300 CTGAAATCAAAGTGTGGGCAGGG + Intergenic
1183036938 22:35147651-35147673 CTGAAATCAAGGTGCCGGCAGGG - Intergenic
1183175551 22:36222457-36222479 CTAAAATCAAGGTGTGGGCATGG + Intergenic
949236788 3:1818748-1818770 CCAAAATCAAGGTGTGGACAGGG + Intergenic
949269237 3:2194850-2194872 CTGAAATCAAGGTGTGAGCAGGG - Intronic
949389314 3:3541698-3541720 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
949783198 3:7712797-7712819 CTGAAATCAAGGTGGCAGCAGGG + Intronic
950796442 3:15514147-15514169 CTGAAATCAAGGTGTCGCCAAGG - Intronic
951502873 3:23409722-23409744 CTGAAATCAAGGTATCAACAGGG + Intronic
951594377 3:24301178-24301200 TTGAAATCAAGGTGTTGACAGGG - Intronic
952258086 3:31712643-31712665 CTGAAATCAAGGTGTTGGCAGGG - Intronic
953123103 3:40065064-40065086 CTGAAATCAAGGTGCAGGCAGGG + Intronic
953717627 3:45329574-45329596 CTGAAATCAAGGTTTCCACAGGG - Intergenic
953953851 3:47215012-47215034 CTAAAATCAAGGTGGCAACAAGG - Intergenic
954974850 3:54683768-54683790 CTGAAATCAAGGTGTTGTCAGGG + Intronic
955022525 3:55134860-55134882 CTAAAATCAAGGTGGAGGCAGGG + Intergenic
955155412 3:56412273-56412295 CTGAAATCAAGGTGTTGGCATGG - Intronic
955569778 3:60291932-60291954 CTGAAATCAAGATATGGACAGGG - Intronic
956692046 3:71887600-71887622 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
956991857 3:74775686-74775708 CTGAAATCAAGGTGCCAACATGG - Intergenic
957152662 3:76505735-76505757 CTGAAATCAAGGTGTTGACAGGG - Intronic
958966347 3:100563061-100563083 CTGAAATCAAGGTGTTGGCAGGG + Intronic
958997581 3:100922728-100922750 CTAAAATCAAGGTGTGGGCAGGG - Intronic
959267081 3:104156237-104156259 CTAAAATCAAGGTGTTGACAGGG - Intergenic
959593634 3:108105496-108105518 CTGAAATCAAGGTACTGGCAGGG - Intergenic
959732133 3:109616731-109616753 CTTAAATCAAGGGAGTGACAAGG - Intergenic
959848661 3:111063016-111063038 CCGAAATCAAGGTATGGGCAGGG + Intergenic
960140763 3:114149910-114149932 CTGAAATCAAGGTGTAGACTGGG - Intronic
960201318 3:114839905-114839927 CTGAAATCAAGGTGTTGGCAGGG - Intronic
960556810 3:119039249-119039271 CTAAAATCAAGGTGTGGACAAGG + Intronic
961345757 3:126262283-126262305 CTGAAATCAAGTTGTTGACAGGG - Intergenic
962294878 3:134174221-134174243 CTGAAATCAAGGTGTAGTCAGGG - Intronic
962305461 3:134282198-134282220 CTGAAATCAAGGTGTGGGGAAGG - Intergenic
962313439 3:134342238-134342260 CTGAAATCAAGGTGTTCACAGGG - Intergenic
962360148 3:134733768-134733790 CTGAGATCAAGGTCTTGGCAAGG - Intronic
963560661 3:146860949-146860971 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
963824152 3:149932982-149933004 CTGAAATCTAGGTTGGAACCTGG + Intronic
963893490 3:150661068-150661090 CTGGAAACAAGGTGGGGGCAGGG - Intronic
964389269 3:156180953-156180975 CTGAGATCAAGGTATGGGCAGGG + Intronic
965353723 3:167647865-167647887 ATGAAATCAAGGTAGAGAAAGGG - Intronic
968545738 4:1196906-1196928 CTGACATCAAGGTGAGGCCAAGG + Intronic
969145855 4:5123547-5123569 CTGAGATCAAGGTGTGGGCAGGG + Intronic
969185531 4:5471500-5471522 CTGAAATCAAGGTGTGGGCAGGG - Intronic
969297123 4:6276776-6276798 CTGAAGTCAAGGTGTGGGCAGGG + Intronic
969304725 4:6319037-6319059 CTGAAACCAAGGTGTGGGCAGGG + Intergenic
969931610 4:10636449-10636471 CTGAAATCAAGGTTGTGAGCAGG - Intronic
969946727 4:10790822-10790844 CTGAAATCAAGGTCTTGGCAGGG + Intergenic
970297456 4:14645683-14645705 CTGAAATCAAAGTGCTGACAGGG - Intergenic
970329123 4:14961202-14961224 CTGAAATCAAGGTGTTGACTAGG + Intergenic
970384090 4:15538549-15538571 CTGAAATCAAGGAAGGGGCAAGG - Intronic
970445654 4:16121349-16121371 CTCAACTCAGGGTGGGGACATGG + Intergenic
971221302 4:24709261-24709283 CTGAAATCAAGGTGTTGGCATGG - Intergenic
971323829 4:25627875-25627897 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
971824421 4:31602960-31602982 CTAAAATCAAGGTGTGGGCAGGG + Intergenic
972184722 4:36514621-36514643 CAGAAATCAAGGAATGGACAGGG + Intergenic
972276471 4:37562802-37562824 CTGGAATCAAGTTCGGTACTTGG + Intronic
973727042 4:53787244-53787266 CTGAAATCAAGGTGTTGGCAGGG + Intronic
974083678 4:57237586-57237608 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
974856933 4:67472094-67472116 CTGAAATCAAGGTGTTGTCAAGG - Exonic
975094907 4:70446359-70446381 CTGAAATCAAGGTGTCTACAGGG + Intronic
975643348 4:76523056-76523078 CTGAAATCAGGGTGGTGGCAGGG + Intronic
975811866 4:78178013-78178035 CTGAAATCAAGGTGTTGTCAAGG + Intronic
975850544 4:78567298-78567320 CTAAAATCAAGGTGTGGTCAGGG + Intronic
976995126 4:91422096-91422118 CTAAAATCAAGGTGTGGACAGGG - Intronic
977021079 4:91760935-91760957 CTGAGATCAAGGTGTGGAAAGGG - Intergenic
977535540 4:98252663-98252685 CTAAAATCAAGGTGTGGGCAGGG - Intergenic
977723796 4:100270776-100270798 CTGAAATCAAGGTATTGGCAGGG + Intergenic
977758332 4:100700434-100700456 CTGAAATCAAGGTGTTGATAAGG + Intronic
977987887 4:103406173-103406195 CTGAAATCAAGGTGTTGACAGGG + Intergenic
979162637 4:117483078-117483100 CTGAAATCAAGGTGTCAACAGGG + Intergenic
979428898 4:120602968-120602990 CTAAAATCAAGGTGTTGACAAGG + Intergenic
979882405 4:125978026-125978048 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
982474795 4:155836858-155836880 CTGAAATGAAAATCAGGACAGGG + Intronic
982857220 4:160399064-160399086 CTGAAATCAAGGTATTGACTGGG + Intergenic
983307397 4:166008855-166008877 CTGAAGGCAAGGTCAGGAAAAGG + Intronic
983793632 4:171830227-171830249 CTGAAATCAAGGTGTTGGCAGGG - Intronic
984465052 4:180088726-180088748 CTAAAATCAAGGTGTGGATAGGG + Intergenic
984702397 4:182826607-182826629 CTGAAATCAAGGCGCGGGCAGGG + Intergenic
984856952 4:184203705-184203727 CTGAAATCCAGGTGCGGGCAGGG - Intronic
984864705 4:184271777-184271799 GTGAAATGCAGGTGGGGACAAGG + Intergenic
985729224 5:1537914-1537936 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
986218257 5:5741911-5741933 CTGAAATCAAGGTGTTGACAGGG + Intergenic
986226268 5:5817399-5817421 CTGAAAATATGGTGGGGACATGG + Intergenic
986269048 5:6215875-6215897 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
986694922 5:10343150-10343172 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
986704464 5:10443700-10443722 CTAAAATCAAGGTGTTGACAGGG + Intronic
987568548 5:19625508-19625530 CTGAAATCAAGGTGTTGGCAGGG + Intronic
987579570 5:19772550-19772572 CTGGAATCAAGGTGTGGACAGGG - Intronic
988293638 5:29325075-29325097 CTGAAATCAAGATGGTGGCAGGG - Intergenic
988483306 5:31647441-31647463 CTGAAATCAAGGTGTTGACAGGG + Intronic
989255526 5:39362481-39362503 CTGAAATCAAGGTGTTGGCAGGG - Intronic
989445802 5:41526922-41526944 CTGAAATCAAGGTGTTGGCAAGG - Intergenic
990175603 5:53104528-53104550 CTGAAATCATGGTGGTGATATGG + Intronic
991131154 5:63123626-63123648 CCGAAATCAAGGTGTCGACAGGG + Intergenic
991500778 5:67274556-67274578 CTGAAATCAAGGCATGTACAAGG + Intergenic
993493226 5:88577521-88577543 CTGAAATCAAGGTGTCTACAGGG + Intergenic
993576090 5:89602497-89602519 CTGAAATCAAGGTATCGGCAAGG + Intergenic
993678940 5:90851294-90851316 CTGAAATTAAGGCAGGGACATGG + Intronic
994728639 5:103465492-103465514 CTAAAACCAAGGTGGTGACACGG + Intergenic
995888444 5:116922139-116922161 CTGAAATCAAGGAGGCGGCAGGG - Intergenic
996414687 5:123197515-123197537 CTGAAATCAAGGTGTGAGCAAGG - Intergenic
996497142 5:124171693-124171715 CTGAAATCAAGGTATTGGCAAGG - Intergenic
997181083 5:131829877-131829899 CTGAAATCAAGGTGTTGGCAGGG - Intronic
997434731 5:133866093-133866115 CTGAAATCAAGGTGCAGGCAGGG - Intergenic
998655757 5:144177456-144177478 CTGAAATCAAGGTTTTGGCAAGG + Intronic
998909377 5:146941876-146941898 CTGAAATCAAGGTGTTGGCAGGG + Intronic
999500924 5:152145884-152145906 CTGAAATGAAGGTAGTGATAGGG - Intergenic
1000803208 5:165754603-165754625 CTGAAATCAAGGTGTGAGCAGGG + Intergenic
1001134459 5:169090844-169090866 CTGAAATCAAGATGTGAACAGGG - Intronic
1001472374 5:172023539-172023561 CTGAAATTAAGGTGTGGGCAGGG + Intergenic
1002003164 5:176210026-176210048 CTGAGATTCAGGTGGGGACATGG + Intergenic
1002223291 5:177700924-177700946 CTGAGATTCAGGTGGGGACATGG - Intergenic
1002329500 5:178431694-178431716 CTGAAATCAAGATGGTGGCAGGG - Intronic
1002329862 5:178434015-178434037 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1002871213 6:1168754-1168776 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
1003027659 6:2571221-2571243 CTGAAGTTAAGGTATGGACAGGG + Intergenic
1003440657 6:6138364-6138386 CTAAAATCAAGGGCAGGAGAGGG + Intergenic
1003550267 6:7097150-7097172 CCAAAATCAAGGTGTGGACAGGG + Intergenic
1003568680 6:7241645-7241667 CTGTAACCAAGGTAAGGACAAGG - Intronic
1003580406 6:7334970-7334992 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1003661558 6:8067031-8067053 CAGAAGTCAGGGTGGGGACAGGG - Intronic
1003976953 6:11353527-11353549 CTGAAATCAAGGTGCTGGCAGGG - Intronic
1004004873 6:11629209-11629231 CTGAAATCAAGGTGGCAGCAGGG - Intergenic
1004248651 6:14003846-14003868 CTGAAATCAATGTTTGGGCAGGG + Intergenic
1004563164 6:16770702-16770724 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1005164013 6:22898088-22898110 CTCCAATCAAGGTGTGGACAAGG - Intergenic
1005224615 6:23627015-23627037 CTAAAATCAAGGTAGAGACTGGG + Intergenic
1005250975 6:23945749-23945771 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1005731806 6:28704815-28704837 GTGAAATCAAGGTGTGAACAGGG - Intergenic
1005809142 6:29502966-29502988 CTGAAATCCAGGTCTGGGCAGGG + Intergenic
1006142857 6:31941255-31941277 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1006695247 6:35925561-35925583 CTGAAATCAAGGTATTGGCAGGG + Intergenic
1007311078 6:40946458-40946480 CTGAGATCAAGGTATGGGCAGGG + Intergenic
1007646065 6:43382153-43382175 CTAAAATTAAGGTGTGGACAGGG - Intergenic
1008538473 6:52526029-52526051 CTGAAATCAAGATGGTGGCAGGG - Intronic
1009032707 6:58080097-58080119 CTGAAATTAAGGTGTTGACAGGG - Intergenic
1009197038 6:60699247-60699269 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1009208319 6:60831865-60831887 CTGAAATTAAGGTGTTGACAGGG - Intergenic
1009486228 6:64225648-64225670 CTTAAATCAAGGTTTTGACAGGG - Intronic
1009540413 6:64949275-64949297 CTGAAATCAAGGTATTGACTGGG + Intronic
1009658338 6:66575290-66575312 CTGAAATCAAGGTACGGCAAAGG - Intergenic
1010068546 6:71715091-71715113 CTGAAATTAAGGTCTGTGCAGGG + Intergenic
1010309481 6:74367464-74367486 CTGAAGTCAAGGTTGGAATAAGG - Intergenic
1010327595 6:74582507-74582529 CTAAAATCAAGGTGGTGGCAGGG - Intergenic
1011984769 6:93429711-93429733 CTGAAATCAAGGTACTGTCATGG - Intergenic
1012387003 6:98693669-98693691 CTGAAATCAAGGTTTTGGCAGGG - Intergenic
1013182407 6:107729222-107729244 CTGAAATCAAGGTGTCCACAGGG + Intronic
1013730354 6:113157302-113157324 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1013788296 6:113807537-113807559 CTGAAATCAAGTTGCTGACAGGG - Intergenic
1015079335 6:129204611-129204633 CTGAAATCAAGGTATCGGCAGGG - Intronic
1016006259 6:139092024-139092046 CTGAAATCAAGGTTTTGGCAGGG - Intergenic
1016070526 6:139733138-139733160 CTGAAATCAAGGTCATGCCCAGG - Intergenic
1016134857 6:140527571-140527593 CTGAAATCGAGGTGCAGACATGG - Intergenic
1016692168 6:146950700-146950722 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1016918952 6:149272379-149272401 TTAAAATCAAGGTGGTGACAGGG + Intronic
1018396023 6:163378624-163378646 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1019125481 6:169837843-169837865 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1019742820 7:2683254-2683276 CTGAAGTCAAGGCTGGGGCAGGG + Intronic
1021370180 7:19835132-19835154 CTGAAATCAAGGTATTGACTGGG + Intergenic
1021463493 7:20914955-20914977 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1021526726 7:21596287-21596309 CTGAAATCAAAGTGTGGGCAGGG + Intronic
1021738570 7:23662794-23662816 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1022342755 7:29484397-29484419 CTGAAATCAAGGTATGGGCAGGG + Intronic
1022792485 7:33702842-33702864 CTAAAATCAAGGTGTGGGCAGGG + Intergenic
1023225900 7:37968693-37968715 CTGAAATCAAGATATGGGCAGGG + Intronic
1023346881 7:39279553-39279575 CTGAAATCAAGGTGTCAACAGGG + Intronic
1023705036 7:42932344-42932366 CTGAAAGCAGGGGCGGGACCGGG + Exonic
1024209966 7:47194649-47194671 CTGAGATCAAGGTCTCAACAGGG - Intergenic
1025148135 7:56522829-56522851 TGGAAATCAAAGTCTGGACATGG + Intergenic
1026318376 7:69247188-69247210 TGGAAATCAAGGTCCTGACATGG - Intergenic
1027536657 7:79411563-79411585 CTAAAATCAAGGTGTTGACAGGG - Intronic
1028109483 7:86921535-86921557 CTGAAATCAAGGTGTGGGCAGGG - Intronic
1028268199 7:88755071-88755093 CTGAAATCAAGGTATTGGCAGGG + Intergenic
1028735211 7:94203501-94203523 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1029946522 7:104539098-104539120 CTAAAATCAAGGTGTTGACAGGG - Intronic
1030284434 7:107811315-107811337 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1030287996 7:107846471-107846493 CTAAAATCAAGGTGCTGACATGG + Intergenic
1030384774 7:108855354-108855376 CTGAAATCAAGGTATGAGCAGGG - Intergenic
1031297691 7:120024216-120024238 CTGAAATCAAGGTCCCGGGAAGG + Intergenic
1031915455 7:127558852-127558874 CTAAAATCAAGGTGTTGACAGGG - Intergenic
1032123369 7:129172958-129172980 CTGAAATCAAGGTGTTGACCAGG + Intergenic
1032509125 7:132457922-132457944 CTGAAACCAAGGTGCGCACAAGG - Intronic
1032863549 7:135904088-135904110 GTGAAATCAAGGTATAGACAGGG + Intergenic
1032879501 7:136074184-136074206 CTGAAATCAAGGTGTTCACAAGG - Intergenic
1033016018 7:137672577-137672599 CTGAAATCAAGGTTTCAACAAGG + Intronic
1033021687 7:137731665-137731687 CAGAAATCAAGGTCAGGCAAGGG - Intronic
1034762355 7:153684902-153684924 ATGAAATCAAGGTCTTGGCAGGG + Intergenic
1035044862 7:155957090-155957112 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1035528438 8:332872-332894 CTGAAATCAGGGTGGGGACAGGG - Intergenic
1035528455 8:332917-332939 CTGAAATCAGGGTGGGAACAGGG - Intergenic
1035528471 8:332962-332984 CTGAAATCAGGGTGGAGACAGGG - Intergenic
1035695078 8:1589993-1590015 CTGAAATCAAGGTGTGGGCAAGG + Intronic
1035915834 8:3621128-3621150 CTGAGATCAAGGTTTGGGCAGGG - Intronic
1036198396 8:6744473-6744495 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1037648150 8:20812516-20812538 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1037755691 8:21708826-21708848 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1037871466 8:22501421-22501443 CTGAAATCAAGGTGTTGCCAGGG + Intronic
1038029072 8:23621249-23621271 CTGAAATCAAGGTGTCCACAGGG + Intergenic
1038482614 8:27912062-27912084 CTGAAATCAAGGTATCCACAGGG - Intronic
1038514735 8:28177314-28177336 CTGATATCAAAGTTGGGAAAAGG - Intronic
1038832479 8:31076917-31076939 CTGCAATTAAGGCCAGGACAAGG - Intronic
1038915344 8:32015025-32015047 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1038925058 8:32129305-32129327 CTGAAATCAAGGTGTTGTCAGGG + Intronic
1038962377 8:32536177-32536199 CTGAAATCAAGGTGTTGACCGGG + Intronic
1040565349 8:48561257-48561279 ATGAAATGAAAGTCTGGACATGG - Intergenic
1040891136 8:52317449-52317471 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1040914028 8:52550622-52550644 CTGAAATCAAGATGTGGGCAGGG + Intronic
1041213849 8:55580359-55580381 CTAAAATCAAGGTGTGGGCAGGG + Intergenic
1041348224 8:56923396-56923418 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
1041644235 8:60235189-60235211 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1041684161 8:60627310-60627332 CTAAAATCAAGGTGGTGGCAGGG + Intergenic
1041880657 8:62746097-62746119 CTGAATTCAAGGTCTTGGCAGGG + Intronic
1042456281 8:69007770-69007792 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1042820174 8:72922056-72922078 CTAAAACCAAGGTGTGGACAGGG + Intronic
1043561520 8:81499483-81499505 CTGAAATCAAATTGGGGAAAGGG + Intergenic
1044048001 8:87462216-87462238 CTAAAATCAAGGTGTGGGCAAGG - Intronic
1044281933 8:90366694-90366716 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1044501242 8:92960776-92960798 CTGAAATCAAGGTCGGGACAGGG - Intronic
1044610666 8:94088775-94088797 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1045932371 8:107642354-107642376 CTGACATCAAGGCTGGAACAGGG + Intergenic
1046647425 8:116801607-116801629 CTGAAGTCAAGGTGTGGGCAGGG + Intronic
1047572055 8:126109950-126109972 CTAAAATCAAGGTGTGCACAGGG + Intergenic
1048153774 8:131921200-131921222 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1048184942 8:132231194-132231216 CTGAAATCAAGGTATTGACAGGG - Intronic
1048253346 8:132885772-132885794 CTGAAATCAAGGTGTGGGCAGGG + Intronic
1048300183 8:133245655-133245677 CCGAAATCAAGGTGTGGGCAGGG - Intronic
1048421129 8:134279353-134279375 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1048927184 8:139281584-139281606 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1049268559 8:141682316-141682338 CTGAAATCAAAGTGTGGGCAGGG + Intergenic
1049285120 8:141770547-141770569 CTGAAATCAAGGTGCTGCCAGGG - Intergenic
1049333140 8:142065654-142065676 CTGAAATCAGGGTATGGCCAGGG - Intergenic
1049768997 8:144370805-144370827 CTGAAATCAAGGTGTCAACAGGG + Intergenic
1050291698 9:4161999-4162021 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1050654206 9:7807832-7807854 CTGAAATCAAGGTGTCAACAGGG - Intronic
1050775412 9:9253857-9253879 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1051587442 9:18741642-18741664 CTGAAATCAAAGTACGGACAGGG + Intronic
1053006118 9:34605795-34605817 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1053276061 9:36784215-36784237 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1054746158 9:68855996-68856018 CTAAAATCAAGGTGTTGACAAGG + Intronic
1055588618 9:77785359-77785381 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1055710462 9:79055285-79055307 CTGAAATCAAGGTCTCAGCAGGG - Intergenic
1056083855 9:83125341-83125363 CTAAAATCAAGGTGCTGACAGGG - Intergenic
1056085834 9:83148565-83148587 CTGAGATCAAGGTCCTGGCAGGG - Intergenic
1056489098 9:87087409-87087431 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1056622099 9:88222925-88222947 CTGAGATCAAGGTGTGCACATGG - Intergenic
1056879705 9:90379561-90379583 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1057266802 9:93622651-93622673 CTAAAATCAAGGTGTGGGCAAGG - Intronic
1057393162 9:94655938-94655960 CTGAAATGAAGGTGGCGGCAGGG - Intergenic
1057857197 9:98610735-98610757 CTGAAATCAAGGTCTTGGCAGGG - Intronic
1057931056 9:99193377-99193399 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1058474378 9:105316979-105317001 CTGAAATCAAAGTGTTGACAGGG + Intronic
1059588658 9:115633246-115633268 CTGAAATCAAGGGGTGGAGAAGG - Intergenic
1059852585 9:118361195-118361217 CTGAGATCAAGTAGGGGACATGG + Intergenic
1059880741 9:118686072-118686094 TTGAAATTAAGGTAGTGACAGGG - Intergenic
1061714812 9:132512109-132512131 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1062104434 9:134745789-134745811 CTGAAATCAAGGTGTAGGCAGGG + Intronic
1062173957 9:135150688-135150710 CTGAAGTCAAGGTCTGGACAGGG + Intergenic
1062624704 9:137437490-137437512 CTGAAAACAAGGTGTGGACAGGG - Intronic
1185456578 X:313808-313830 CTGAGATCAAGGTGAGGACAGGG - Intronic
1185521915 X:746814-746836 CTGAGATCAAGGTGTGGACAGGG - Intergenic
1185558003 X:1036537-1036559 CTGACATCAAGGTGTGGACAGGG - Intergenic
1185663661 X:1746815-1746837 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185700186 X:2225793-2225815 CTGACATCAAGGTGTGGGCAGGG - Intronic
1185758208 X:2668774-2668796 CTGAAATCAAGGTGTGGGCAGGG + Intergenic
1185770311 X:2760929-2760951 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1185770443 X:2761820-2761842 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1185822357 X:3217776-3217798 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1185837035 X:3354470-3354492 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1185853467 X:3510586-3510608 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185895115 X:3851545-3851567 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185895364 X:3853750-3853772 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185900233 X:3889970-3889992 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185900481 X:3892174-3892196 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185905349 X:3928401-3928423 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185905597 X:3930605-3930627 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185942238 X:4334617-4334639 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185955354 X:4483176-4483198 CCGGAATCAAGGTGTGGACAGGG - Intergenic
1185986961 X:4845478-4845500 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1186009318 X:5111513-5111535 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1186188655 X:7046390-7046412 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1186813781 X:13215619-13215641 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1187009301 X:15264079-15264101 CTGAAATCAAGGTGTGGACAGGG + Intronic
1188044940 X:25414829-25414851 CTGAAATCCAGGTATTGACAAGG - Intergenic
1188211789 X:27434330-27434352 CTGAAATCAAGGTGTTGATAGGG - Intergenic
1189275206 X:39780486-39780508 CTGAGATCAAGGTCTCGGCAGGG - Intergenic
1189365489 X:40384747-40384769 CTGAAATCAAGGTGGCCATAGGG + Intergenic
1189620041 X:42826136-42826158 CTGAAATCAAGGTGGCTGCAGGG + Intergenic
1189735301 X:44064072-44064094 ATGAAATCAAGGGAGGGAGAAGG - Intergenic
1189869411 X:45366837-45366859 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1190118627 X:47642211-47642233 CTGAAATCAAGGTATTGGCAGGG - Intronic
1190643937 X:52507136-52507158 CTGAAATCAAGGTGTGGGCAGGG - Intergenic
1192607080 X:72529532-72529554 CTAAAATCAAGGTATGGGCAGGG - Intronic
1192901548 X:75503821-75503843 CTGAAATCAAGGTGTAGGCAGGG + Intronic
1193226305 X:78988346-78988368 CTGAAAACAGGGTGGGGATAGGG + Intergenic
1193772115 X:85599979-85600001 CTGAAATCAAGGTCTTAGCAGGG - Intergenic
1193913941 X:87342326-87342348 CTGAAATCAAGGTTTCCACAGGG - Intergenic
1194354577 X:92866684-92866706 CACAAGTCAAGGGCGGGACAAGG + Intergenic
1194359303 X:92929226-92929248 CTAAAATCAAGGTCTTGGCATGG + Intergenic
1196237632 X:113300641-113300663 CAGGAATCAAGGGCGGGCCAGGG - Intergenic
1196265026 X:113633436-113633458 CTGAAATCAAGGTGTCAACAGGG - Intergenic
1197651218 X:129066826-129066848 ATGAAATCAAGGTTGTGTCAAGG - Intergenic
1198402998 X:136285710-136285732 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1199692450 X:150318872-150318894 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1199845745 X:151692060-151692082 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1199935938 X:152573704-152573726 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1200257998 X:154595292-154595314 CTGAAGTCAAGGTATGGGCAGGG - Intergenic
1200667499 Y:6045061-6045083 CTAAAATCAAGGTCTTGGCATGG + Intergenic
1200764539 Y:7069418-7069440 CTGAGATCAAGGTGAGGGCAGGG + Intronic
1200809933 Y:7473707-7473729 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1201239530 Y:11945280-11945302 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1201256605 Y:12113757-12113779 CTGAGATCAAGGTGTGGGCAAGG - Intergenic
1201299947 Y:12496798-12496820 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1201301597 Y:12509900-12509922 CTGAAATCAAGGGGCAGACAGGG - Intergenic
1201474667 Y:14367267-14367289 CTGAGATCAAGGTGTGGACAGGG - Intergenic