ID: 1044501306

View in Genome Browser
Species Human (GRCh38)
Location 8:92961602-92961624
Sequence TATTACCTATAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044501306_1044501309 -3 Left 1044501306 8:92961602-92961624 CCTTCCACCTGCTATAGGTAATA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1044501309 8:92961622-92961644 ATAAACTATAATCCACAATTAGG No data
1044501306_1044501311 10 Left 1044501306 8:92961602-92961624 CCTTCCACCTGCTATAGGTAATA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1044501311 8:92961635-92961657 CACAATTAGGACTTTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044501306 Original CRISPR TATTACCTATAGCAGGTGGA AGG (reversed) Intronic
902852437 1:19170774-19170796 TATTGGCTCTAGCAGGTGCAAGG - Exonic
904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG + Intergenic
906188232 1:43878073-43878095 TATGACCTAGAGCATCTGGAGGG - Intronic
909570414 1:77103847-77103869 AACTACCTATAGCTGGTAGAAGG + Intronic
910628568 1:89334588-89334610 TCGTACCTAGAGCAGGTGGAAGG + Intergenic
911239863 1:95453498-95453520 TAAGTCCTATAGCAGGTGGGTGG + Intergenic
912372023 1:109181058-109181080 TATTACCTATAGCATAGTGAGGG + Intronic
912401911 1:109400539-109400561 TATTAAGTATAGCATGTTGATGG - Exonic
921660863 1:217800762-217800784 AATTAATTTTAGCAGGTGGAAGG - Intronic
1073904440 10:108261603-108261625 TATCATCTATAGCAGGTGCTTGG - Intergenic
1077892019 11:6425690-6425712 TATTACCAATAAAAGGGGGAAGG - Intergenic
1079963754 11:26955112-26955134 TATTACCTGTAGCCTTTGGAAGG - Intergenic
1080566308 11:33512714-33512736 TATTACCTAGAGCAGGGGCCGGG - Intergenic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1085014376 11:73163264-73163286 TTTTACCTTAAGCTGGTGGAGGG + Intergenic
1088970084 11:114766282-114766304 TTTGATTTATAGCAGGTGGAAGG - Intergenic
1090903316 11:131051593-131051615 TATTAGTTGTTGCAGGTGGAGGG + Intergenic
1096952948 12:55494216-55494238 AATTACCTATAGCAATAGGAAGG + Intergenic
1099854948 12:88152240-88152262 TACTACCTGTAGAAGGTGAAGGG + Intronic
1101711008 12:107266405-107266427 TAAAACCTATAGAAGGTAGAAGG + Intergenic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1104899339 12:132179927-132179949 CATTCCCTACAGCAGGTGGTGGG - Intergenic
1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG + Intergenic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1119286950 14:73462859-73462881 TATTATGTAAAGCAGGCGGAAGG - Intronic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1121556546 14:94842110-94842132 TAGAACCAATAGGAGGTGGATGG - Intergenic
1122805991 14:104257342-104257364 TCTTGCTTATTGCAGGTGGAAGG - Intergenic
1125071753 15:35563008-35563030 TATGTCCTATAGCAGGTAGCTGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG + Intronic
1131908567 15:97171020-97171042 TATTACATACAACAGGGGGATGG + Intergenic
1132223385 15:100122244-100122266 TATTAGCTATAACAGGTGGTTGG - Intronic
1140571955 16:76118001-76118023 TGTTTCCTATAACAGGTGGTGGG + Intergenic
1145737559 17:27243696-27243718 TTTTACTTATGGCAGGTGGGTGG - Intergenic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1153473600 18:5472720-5472742 TGTAACCTATAGAAGTTGGAAGG + Intronic
1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG + Intronic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1160135414 18:76267113-76267135 TTTGACCTATAGAAGGTGCATGG - Intergenic
1160761683 19:788716-788738 TTTTATCCATGGCAGGTGGAAGG - Intergenic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
925802994 2:7619958-7619980 TATGACCCATAGCAATTGGAAGG - Intergenic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
929372052 2:41237188-41237210 TATTACTTATAGTAACTGGAAGG + Intergenic
930231272 2:48846316-48846338 TATTTCATGGAGCAGGTGGAAGG + Intergenic
932145407 2:69311396-69311418 TAATACCTGTAACATGTGGAAGG - Intergenic
933010305 2:77053660-77053682 TATTACCTCTAGCAGATAAAAGG - Intronic
939320175 2:140609836-140609858 TATTACCTAGAGTTGCTGGATGG - Intronic
940253807 2:151708104-151708126 GATATCCTAGAGCAGGTGGAAGG - Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
947938772 2:234030073-234030095 TATTACTTACAGCAGGTGCCAGG - Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
954830607 3:53418160-53418182 TGTTACCTATGTTAGGTGGAAGG + Intergenic
954977477 3:54709948-54709970 TAATACCTCTACCAGGTGGTAGG - Intronic
955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG + Intronic
956782230 3:72613087-72613109 TAATCCCTACAGCAGGTGGGAGG + Intergenic
957014920 3:75051946-75051968 TATTATCTATATCATGTGGAAGG + Intergenic
957935942 3:86942768-86942790 TATCTCCTATACCAGGTAGAAGG + Exonic
967860757 3:194149645-194149667 TATTTCCTCTGGCAGGTGGCAGG - Intergenic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
975031442 4:69622948-69622970 TATGACCCATAGCAAGTGGGTGG - Intronic
977270073 4:94907326-94907348 CATTGCCTATAACAGGTGAAAGG + Intronic
978987681 4:115034324-115034346 TAATACCTACAGCAAGTGGAAGG - Intronic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
985359107 4:189153587-189153609 TATTTACTAAAGCAGGTGGTGGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1000653315 5:163845197-163845219 TCCTACCTCTAGCAGATGGAAGG - Intergenic
1000697406 5:164404757-164404779 TATTACATATAGCACATGCATGG + Intergenic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1004891859 6:20108588-20108610 AATTCCCTATAGCCGATGGAGGG - Intronic
1006312242 6:33268967-33268989 TAATGTCCATAGCAGGTGGATGG - Intronic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1016054465 6:139565274-139565296 TGTTGCCTATAGCTGGGGGAAGG + Intergenic
1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG + Intergenic
1018606837 6:165606540-165606562 TTTGATCAATAGCAGGTGGAAGG - Intronic
1022593429 7:31688164-31688186 TATTACCCATAGAATGTGCATGG - Intronic
1024601165 7:50982797-50982819 TATTACCTACTGCTTGTGGATGG - Intergenic
1024693701 7:51833029-51833051 TATTGCCTATAGGATGTGAATGG - Intergenic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1026103354 7:67400890-67400912 TATTTCTTATAGCAAGTGAATGG + Intergenic
1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG + Intronic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1054743988 9:68835720-68835742 TATTGACTATTGAAGGTGGAAGG + Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1062120228 9:134830138-134830160 TACTGACTATACCAGGTGGAAGG - Intronic
1186046358 X:5541140-5541162 TCTTACCTCTATCAGATGGAAGG - Intergenic
1189126321 X:38451161-38451183 TATTACTTAGAGGAGGGGGAAGG - Intronic
1189765948 X:44372333-44372355 TCTTACCTAAAGTAAGTGGAGGG + Intergenic
1192194829 X:69021283-69021305 TATAACCTGTAGCAGGAGGGAGG - Intergenic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1196034762 X:111132219-111132241 TGTCACCCATAGGAGGTGGATGG + Intronic