ID: 1044501309

View in Genome Browser
Species Human (GRCh38)
Location 8:92961622-92961644
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044501307_1044501309 -7 Left 1044501307 8:92961606-92961628 CCACCTGCTATAGGTAATAAACT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1044501309 8:92961622-92961644 ATAAACTATAATCCACAATTAGG No data
1044501306_1044501309 -3 Left 1044501306 8:92961602-92961624 CCTTCCACCTGCTATAGGTAATA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1044501309 8:92961622-92961644 ATAAACTATAATCCACAATTAGG No data
1044501308_1044501309 -10 Left 1044501308 8:92961609-92961631 CCTGCTATAGGTAATAAACTATA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1044501309 8:92961622-92961644 ATAAACTATAATCCACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr