ID: 1044503117

View in Genome Browser
Species Human (GRCh38)
Location 8:92985373-92985395
Sequence GGTGGAATCCAGGAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044503117 Original CRISPR GGTGGAATCCAGGAGCTAGG AGG (reversed) Intronic
900495990 1:2976453-2976475 GGTGGACACCAGGATCCAGGTGG - Intergenic
901829382 1:11882924-11882946 GCTGACAGCCAGGAGCTAGGCGG - Intergenic
902179442 1:14676775-14676797 GGTGGGTGCCAGGAGCTATGGGG + Intronic
903182362 1:21611414-21611436 GGTGGAAGACAGGAGGCAGGTGG + Intronic
904145958 1:28391466-28391488 GGTGGTTACCAGGAGCTGGGTGG + Intronic
904538646 1:31217876-31217898 CCTGGAATCCAGGAGCCAAGAGG - Intronic
905859122 1:41335521-41335543 GGTGGTTTCCAGGGGCTAGGGGG - Intergenic
906591953 1:47033290-47033312 AATGGAATCCAGGAGTTAGTAGG - Exonic
907539074 1:55195770-55195792 GGTGGGTGCCAGGAGCTAGGGGG + Intronic
908119164 1:60969434-60969456 GGTGGTTGCCAGGAGCTAGGTGG - Intronic
908776012 1:67640770-67640792 GGTGGTTGCCAGGGGCTAGGAGG + Intergenic
908930744 1:69313701-69313723 GGTGGTTACCAGGAGCCAGGGGG - Intergenic
909571936 1:77123612-77123634 GGTGGCTGCCAGGAGCTGGGAGG + Intronic
910267346 1:85351786-85351808 GGTGGTTTCCAGGAGCCATGGGG + Intronic
912394218 1:109327860-109327882 GGTAGTTTCCAGGAGCTGGGAGG - Intronic
912468319 1:109889308-109889330 GTTGGGATCCAGAAGCTAAGAGG + Intergenic
912629341 1:111233546-111233568 GCTGGCATCCAGGAGGGAGGTGG + Intronic
913071046 1:115298806-115298828 GGTGGAAACTAGGAGAAAGGGGG - Intronic
917203650 1:172545122-172545144 GGTGGGATCAAGGATATAGGAGG + Intronic
918509007 1:185289818-185289840 GGTGGTTACCAGGGGCTAGGAGG + Intronic
919801137 1:201355218-201355240 CGTGGAATCCAGGAGGAAAGAGG + Intergenic
920188528 1:204177606-204177628 GGAGGAAGCCAAGACCTAGGAGG + Intergenic
920404264 1:205697247-205697269 GGAGGAAGTCAGGAGCTGGGAGG + Intergenic
921725914 1:218523233-218523255 GGTGGTTGCCAGGGGCTAGGGGG + Intergenic
922091430 1:222399132-222399154 GGTGGGATCAAGGAGCTATGTGG - Intergenic
922185391 1:223270004-223270026 GGGCACATCCAGGAGCTAGGAGG + Intronic
922419671 1:225451099-225451121 GGTGGAATCCAACAGCACGGAGG - Intergenic
922575915 1:226660532-226660554 GATGGAATCCAGGAGAGAGGAGG - Intronic
923014389 1:230114606-230114628 GGTGGCATCCAGGACTTACGAGG - Intronic
923829353 1:237538059-237538081 GGTGGAAAAGAGGAGATAGGAGG + Intronic
923952519 1:238974705-238974727 GGTGGCTTCCAGGAGCTTGGAGG - Intergenic
924327263 1:242908540-242908562 GGTGGTTACCAGGAGCTGGGAGG + Intergenic
1063408777 10:5820530-5820552 GGTGGAAGACTGGAGCCAGGAGG - Intronic
1063471039 10:6285723-6285745 GGTGGTTGCCAGGAGCTGGGAGG - Intergenic
1064638003 10:17388243-17388265 AATGGAATCCAGGATCCAGGAGG - Intronic
1066068342 10:31778720-31778742 GGTGGCCTCCAGGAACTGGGAGG - Intergenic
1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG + Intergenic
1067064542 10:43096337-43096359 GGTGGAAGCCAGGCGCCAGCAGG - Intronic
1067851702 10:49758929-49758951 AGTGGGCTCCAGGACCTAGGTGG - Intronic
1068204829 10:53836372-53836394 AGTGGAACCCAGCAGCAAGGAGG + Intronic
1068259025 10:54554204-54554226 TGTGTAATCCAGGAGGTAAGGGG - Intronic
1068930608 10:62585268-62585290 CATGGAAGCCAGGAGATAGGGGG + Intronic
1069199415 10:65594017-65594039 GGTGCATTCCAGGAGTGAGGGGG + Intergenic
1069322521 10:67189300-67189322 GGTGGTTACCAGGGGCTAGGGGG + Intronic
1069777221 10:70934229-70934251 GGTGGAACCAAAGAGCTGGGGGG - Intergenic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1070677821 10:78424650-78424672 GGCTGAACCCAGGTGCTAGGTGG - Intergenic
1070727218 10:78800606-78800628 GGTGGATTCCAGGAGCAAACTGG + Intergenic
1070776505 10:79112951-79112973 GCTGGGAGCCAGGAGCCAGGAGG - Intronic
1070798807 10:79232988-79233010 GCTGGAAGCCAGGAGCCAAGAGG - Intronic
1070877180 10:79825773-79825795 GGTGGAATCCAGACGCCGGGCGG + Intergenic
1070923382 10:80203082-80203104 GGGTGAATCCAGGAGGAAGGAGG + Intronic
1071643676 10:87341817-87341839 GGTGGAATCCAGACGCCGGGCGG + Intergenic
1074562969 10:114550721-114550743 AGTGGTTTCCAGGAGTTAGGAGG - Intronic
1075148991 10:119909379-119909401 GGTGGAATGCTTGAGCCAGGGGG + Intronic
1076012582 10:127002583-127002605 GGAGAACTCCAGGAGCTGGGGGG - Intronic
1076068102 10:127464740-127464762 GGTGGCAACCAGGAGCAAAGAGG + Intergenic
1077609550 11:3635966-3635988 GATGGAGGCCAGGGGCTAGGTGG + Intergenic
1078190307 11:9088698-9088720 GGTTGGGTCCAGGAGCAAGGAGG + Intronic
1078267843 11:9768106-9768128 GGTGGAATCCAGGCAGTGGGTGG + Intergenic
1078353105 11:10611545-10611567 GGTTGAATTCAGGAGGAAGGTGG - Intronic
1079851896 11:25545320-25545342 GGTGGTTGCCAGGAGCTGGGGGG + Intergenic
1080009051 11:27439230-27439252 GGTGGATGCCAAGGGCTAGGGGG - Intronic
1080608011 11:33880494-33880516 GGTGGTTGCCAGGAGCTAGGGGG + Intronic
1081948763 11:47023620-47023642 GGTGATTGCCAGGAGCTAGGGGG - Intronic
1082616313 11:55364618-55364640 GGTGGATACCAGGGGCTAAGGGG - Intergenic
1083211970 11:61193858-61193880 GGTGGAAGGCAGGAGAGAGGAGG - Intergenic
1083345229 11:61984874-61984896 GGTGGTTTCCAGGAGCTGAGGGG - Intergenic
1086089954 11:82995578-82995600 GGTGGAGTTGAGGAGCTGGGAGG + Intronic
1086279699 11:85171585-85171607 GGCTGAATCCAGGAGTTAAGTGG + Intronic
1088469265 11:110176408-110176430 TGTGGAAGGCAGGAGCCAGGAGG - Intronic
1089264346 11:117247766-117247788 GCTTGAATCCAGGAGGCAGGAGG + Intronic
1089722287 11:120437740-120437762 GGTGGCTGCCAGGGGCTAGGGGG - Intronic
1089723619 11:120452911-120452933 GCTTGAATCCAGGAGGTGGGTGG + Intronic
1091355193 11:134932389-134932411 GGTGGTCTCCAGGATCTGGGAGG + Intergenic
1091644358 12:2262643-2262665 GGAGGCATCCAGGAGCCAGAGGG + Intronic
1094446643 12:30538349-30538371 GGTGGTTACCAGGAGCTGGGAGG - Intergenic
1095660844 12:44733535-44733557 GATGGTTTCCAGGCGCTAGGAGG + Intronic
1097112068 12:56667661-56667683 GGTAGATGCCAGGAGCTGGGGGG + Intronic
1097299673 12:58004794-58004816 GGTGATATCCAGTAGATAGGGGG + Intergenic
1097492115 12:60283042-60283064 GGTGGGAGCCAGGAGCTGGCAGG - Intergenic
1098413564 12:70207463-70207485 GGTGTTTGCCAGGAGCTAGGAGG - Intergenic
1099230656 12:80020108-80020130 AGTGAAACCCAGGAGTTAGGTGG + Intergenic
1102047232 12:109837074-109837096 GGGGCAGTCCAGGAGCTACGTGG - Intergenic
1102144097 12:110641595-110641617 GCTGGAATCCAGCAGCTAATGGG - Exonic
1102560300 12:113757287-113757309 GGTGGAGGCCTGGAGCTGGGAGG - Intergenic
1102995081 12:117342967-117342989 AGTGGAAGCCAGGAGCTGGGAGG - Intronic
1103703291 12:122858910-122858932 GGTGGGAGCCAGGTGCGAGGTGG - Exonic
1103740908 12:123091017-123091039 GCAGGAATCCAGGAGGAAGGAGG + Intronic
1104946003 12:132415153-132415175 GGCAGAATCCAGGAGCAGGGTGG + Intergenic
1105202684 13:18193595-18193617 TGTGGGCTCCAGGACCTAGGTGG - Intergenic
1105250916 13:18697973-18697995 GGTGGGATCCAGGAGCACTGAGG + Intergenic
1106106077 13:26734537-26734559 GGGGGAAGCCAGGGGCTAGAAGG + Intergenic
1106216392 13:27704840-27704862 GGTGCTTTCCAGGGGCTAGGGGG + Intergenic
1106566386 13:30888224-30888246 GTTGGAATCGAGGACCTGGGTGG - Intergenic
1107596216 13:41965412-41965434 GGTGGGAGACAGGGGCTAGGGGG + Intergenic
1108067408 13:46592373-46592395 GGAGAAATCCAGGAGCTAAAAGG - Intronic
1108407111 13:50115538-50115560 CTTAGAACCCAGGAGCTAGGAGG - Intronic
1110482601 13:75997766-75997788 GGTGGTTGCCAGGAGCTAGAGGG - Intergenic
1112688568 13:101862155-101862177 GGTGGATTCCAGGAACATGGTGG + Intronic
1113005888 13:105701699-105701721 GCTTGAACCCAGGAGCCAGGAGG - Intergenic
1113984037 13:114299702-114299724 GGTGGATGCCAGGAGCAAGAGGG - Intronic
1115214670 14:31002816-31002838 GGTGGTTTCCAGGAGCTAGGAGG + Intronic
1115481109 14:33862107-33862129 GGTGGAATCCAGGACCTTTTAGG - Intergenic
1115904273 14:38189656-38189678 GGTGGAAACCAGCAGAGAGGCGG - Intergenic
1116423290 14:44759350-44759372 GGTGGTTGCCAGGGGCTAGGGGG + Intergenic
1116851648 14:49914734-49914756 GCTTGAACCCAGGAGGTAGGTGG + Intergenic
1117327851 14:54685280-54685302 GGTGGCTGCCAGGAGCTGGGGGG - Intronic
1117955937 14:61123758-61123780 GGGGGAAGCCAGGAGCCTGGAGG - Intergenic
1118905375 14:70019601-70019623 AGTGTAATCCTGGAGCTGGGAGG + Intronic
1119720080 14:76884606-76884628 GGTGGAAACCAGGAGTCAGCTGG - Intergenic
1119768577 14:77206098-77206120 GGTAGCCTCCAGGAGGTAGGGGG - Intronic
1119881391 14:78102727-78102749 GGTGATTTCCAGGAGCTAGGGGG + Intergenic
1120866305 14:89298260-89298282 GGTGGTTGCCAGGAACTAGGTGG + Intronic
1121095617 14:91216169-91216191 GGTGGAGAGCAGGAGGTAGGGGG + Intronic
1121220515 14:92281415-92281437 GGTGGAATCTTGGAGCTGGAAGG - Intergenic
1121272582 14:92648170-92648192 GGGGGAAGCCAGGAGCTAATGGG - Intronic
1121338970 14:93093827-93093849 GGTGGAAGCCAGGGGCTTGTGGG - Intronic
1121473880 14:94175802-94175824 GCTGCAGTCCAGGAGCTAGAAGG + Intronic
1121919997 14:97871930-97871952 TGGGGAATCCAAGAGTTAGGAGG + Intergenic
1122440124 14:101726017-101726039 GGTGGGGACCAGGAGCTGGGAGG + Intergenic
1123122804 14:105925882-105925904 CGTGGAACCCAGGAGCAAGCTGG - Intronic
1123457732 15:20441286-20441308 AGTGGAGTCCTGGAGCCAGGCGG - Intergenic
1123660338 15:22559131-22559153 AGTGGAGTCCTGGAGCCAGGCGG + Intergenic
1123892542 15:24795714-24795736 GGTGCAATCAGGGAGCTTGGAGG - Intergenic
1124263877 15:28216440-28216462 AGTGGAGTCCTGGAGCCAGGCGG - Intronic
1124314197 15:28653620-28653642 AGTGGAGTCCTGGAGCCAGGCGG + Intergenic
1125243911 15:37611629-37611651 GGTGGTTTTCAGGAGCTGGGGGG - Intergenic
1125632879 15:41162365-41162387 GGTGGAATCTAGGAGGGAAGCGG - Intergenic
1125917116 15:43497703-43497725 GGTGGCTGCCAGGAGCTAGGAGG + Intronic
1125929383 15:43589750-43589772 GCTGGAGTCCAGGAGGAAGGGGG - Intronic
1125942550 15:43689582-43689604 GCTGGAGTCCAGGAGGAAGGGGG - Intergenic
1128160200 15:65418656-65418678 GGTGGGTGACAGGAGCTAGGGGG - Intronic
1129234439 15:74215355-74215377 GGTGGTTGCCAGGAGCTGGGGGG + Intergenic
1129342056 15:74892571-74892593 GGTGGACAGCAGGGGCTAGGTGG + Intronic
1129528393 15:76239548-76239570 GGTGGCTTCCAGGGGCTGGGAGG - Intronic
1129762668 15:78139770-78139792 GGTGGAAAGCAGGAGCAAGGGGG + Intronic
1129919368 15:79307153-79307175 GGTGGTTACCAGGGGCTAGGGGG - Intergenic
1130806268 15:87326788-87326810 TCTGGAATCCAGGATCTTGGGGG + Intergenic
1131181286 15:90241655-90241677 AGAGGAAGCCAGGAGCTGGGAGG - Exonic
1132208679 15:100004369-100004391 GGTGGGCTCCTGGAGCCAGGGGG - Intronic
1132887866 16:2190342-2190364 GGTGGAACCCAGGAGCTCTGGGG + Exonic
1133470617 16:6071749-6071771 GGTGGTAACCAGGAGCCACGGGG - Intronic
1139618747 16:68119314-68119336 GATGGAATACAGGACCTAAGTGG - Intronic
1139890599 16:70251301-70251323 CGTGGGGTCCAGGAGCCAGGTGG + Exonic
1141914677 16:87087136-87087158 GGTAGAATCCAGGAGCTAAGAGG + Intronic
1142833828 17:2569762-2569784 GGTAGGACCCAGGAGCGAGGTGG + Intergenic
1143593933 17:7902929-7902951 GTTGGGCCCCAGGAGCTAGGAGG - Exonic
1143610640 17:8015812-8015834 GGTGGACTCCATGCGCGAGGCGG - Exonic
1144689369 17:17250074-17250096 GGTGGTTTCCAGGGGCTGGGAGG - Intronic
1144707530 17:17379490-17379512 GGTGGTTTCCTGGAGCTGGGGGG - Intergenic
1146600111 17:34206622-34206644 AGTGGAATGCAGGAGCTCAGGGG + Intergenic
1149378192 17:56066740-56066762 GGTGGTTTCCAGGGGCTATGGGG - Intergenic
1149645818 17:58240911-58240933 GGTGGTTGCCAGGAGCTAGGGGG + Intronic
1150468845 17:65418674-65418696 GGTGGAAGCCTGAAGCCAGGGGG - Intergenic
1150868696 17:68880583-68880605 GGTGGCACCCAGAAGCTTGGAGG - Intronic
1151379737 17:73717468-73717490 GGTGGGGTCCAGGAGGCAGGTGG + Intergenic
1151535889 17:74738534-74738556 GGTGGAATCACCGAGCTGGGTGG + Intronic
1151645755 17:75430342-75430364 GCTGGACTCCAGCAGCCAGGGGG + Intergenic
1151750409 17:76034017-76034039 GCAGGGATCCAGGAGCTCGGAGG + Intergenic
1151903351 17:77032347-77032369 GCTGGAATCCAGGTGCTGGTAGG - Intergenic
1152073692 17:78146346-78146368 GGGGGAGGCCAGGAACTAGGAGG + Exonic
1152538122 17:80962016-80962038 GGTGGAAGGCAGGAGCCACGGGG + Intronic
1153631373 18:7073420-7073442 GGTGGTTGCCAGGAGCTGGGAGG - Intronic
1153825061 18:8867480-8867502 GGTGGTTACCAGGAGCTAGAGGG + Intergenic
1154437929 18:14360941-14360963 GGTGGGATCCAGGAGCACTGAGG - Intergenic
1155149739 18:23113529-23113551 GGTGGTAGCCAGGGGCTGGGGGG - Intergenic
1155168929 18:23252799-23252821 GGCGGAATCCAGGAGCCTGAAGG - Intronic
1157465712 18:47943158-47943180 GGTGGCATCAAGGAGGTTGGGGG + Intergenic
1157690315 18:49676577-49676599 GGTGGTTTCCAGGGGCTGGGAGG + Intergenic
1158932913 18:62338642-62338664 GGTGGTTTCCAGGAGCTTGAGGG + Intronic
1159413756 18:68116979-68117001 GGTGGTAACCAGGGGCTGGGTGG + Intergenic
1160788476 19:912437-912459 GGTGGAACCGAGGAGTTGGGGGG + Intronic
1160806780 19:995414-995436 GCTGGGATCCAGGCGCTGGGTGG - Intronic
1160977939 19:1802894-1802916 GGAGGGAGCTAGGAGCTAGGAGG - Intronic
1161028357 19:2046898-2046920 GGTGAATCCCAGGAGCTTGGGGG - Intronic
1161068059 19:2248078-2248100 GATGGACGCCAGGAGCTGGGGGG - Exonic
1161068086 19:2248141-2248163 GGTGGACTCCAGGAGCTGGGGGG - Exonic
1161462391 19:4406034-4406056 AGTGGAAGCCTGGAGCTAGAGGG + Intronic
1162549713 19:11351668-11351690 GGTGGAGGCCAGGTGATAGGAGG + Intronic
1162780565 19:13004768-13004790 GGTGGCTGCCAGGAGCAAGGAGG - Intronic
1162894543 19:13757517-13757539 GGCGGCATCCAGCAGTTAGGGGG - Intronic
1162975298 19:14204869-14204891 GGTGGAAGCCAGGCGGAAGGGGG + Intronic
1163176442 19:15566958-15566980 GGAGGCATCCAGGAGAGAGGTGG - Intergenic
1163832131 19:19552095-19552117 TGGGGAATCCAGCAGCTGGGCGG + Intergenic
1164473972 19:28559112-28559134 AGTGATATCCAGGAGTTAGGAGG - Intergenic
1164564324 19:29315006-29315028 GCTGGACTCCAGGAGCTTGTTGG - Intergenic
1165358252 19:35317436-35317458 GGTGGGGTCCAGGAGCTGGGTGG - Intergenic
1165958157 19:39515060-39515082 GGTGGAACCCGGGGGCCAGGTGG + Intergenic
1166535543 19:43571986-43572008 GGTGGCATCCAGGAGGCAGTTGG - Intronic
1166624908 19:44342730-44342752 GCTGGAATCCAGGAGGTGGAGGG + Intronic
1166748964 19:45155707-45155729 GGGGGAAGCCTGGAGCTGGGCGG + Intronic
1166873863 19:45885791-45885813 GGTGGAACGCGGGAGCTGGGCGG - Exonic
1167490095 19:49787794-49787816 GGTGGCAGCCAGGGGCTGGGGGG - Intronic
1167679634 19:50911346-50911368 AGTGGAATCCAGGAGCCCAGAGG - Intergenic
1168164965 19:54540712-54540734 AGTGGAAGCCAGGAGCCTGGTGG + Intronic
1168329366 19:55557776-55557798 GGTGGTTGCCAGGAGCTAGGAGG - Intergenic
1168512364 19:56983013-56983035 GGTGGCAGCCAGGGGCTTGGGGG + Intergenic
1168571711 19:57476307-57476329 GGTGGGAACCAAGAGCAAGGGGG - Intronic
1168580449 19:57551538-57551560 GGTGGAGTCCAGGAGCTATGTGG + Intronic
925273664 2:2633833-2633855 GGTGGTTACCAGGAGCTGGGAGG - Intergenic
925647043 2:6045776-6045798 GGTGTGATCCAGTAGGTAGGTGG - Intergenic
926094836 2:10074397-10074419 GGAGGAATCCAGGTGAGAGGTGG - Intronic
926701792 2:15808958-15808980 GGTGGAAAGTAGGGGCTAGGAGG + Intergenic
927493580 2:23537081-23537103 AGTGGCATCCAGGGGCAAGGTGG - Intronic
929837065 2:45412290-45412312 GGGGGAAACCAGGAACTAGTTGG + Intronic
930681372 2:54260075-54260097 GGTGGAATCTAGTACCTAAGTGG + Intronic
931430331 2:62203866-62203888 GGTGGGAAACAGGAGCTAAGTGG - Intronic
931762956 2:65432687-65432709 AGTGGAAGCCAGGAGGGAGGGGG - Intergenic
932434679 2:71695964-71695986 GGTGGGATGCAGGAGGCAGGTGG + Intergenic
932854635 2:75220383-75220405 GGTGGTTACCAGGGGCTAGGGGG - Intergenic
934972847 2:98776895-98776917 GCTTGAACCCAGGAGCCAGGAGG - Intergenic
936061099 2:109296184-109296206 AGTGGAAGCCAGGAGATGGGAGG - Intronic
936107944 2:109641569-109641591 GATGGTTTCCAGGGGCTAGGAGG + Intergenic
937703026 2:124885631-124885653 AGTGGTTTCCAGGAGCTAAGAGG - Intronic
937903084 2:127037653-127037675 GGTTGCATCCAGGAACTTGGAGG - Intergenic
938018185 2:127885385-127885407 GGTGGAATCCAGACGCCGGGCGG + Intronic
938496399 2:131800295-131800317 GGTGGACACCAGGTGCCAGGAGG + Intronic
941692164 2:168512157-168512179 GCTGGGTGCCAGGAGCTAGGAGG + Intronic
942266563 2:174233205-174233227 GGTGGTTTCCAGGGGCTGGGGGG + Intronic
943542245 2:189231151-189231173 GGTGGTTGCCAGGAGCTAGGAGG + Intergenic
943830744 2:192458632-192458654 GGTGATTTCCAGGAGCTGGGTGG - Intergenic
944117374 2:196203877-196203899 GGTGGTTTCCAGGGGCTAGGGGG - Intronic
947684039 2:232065264-232065286 GGTGGTTGCCAGGAGCTGGGGGG - Intronic
948456230 2:238105868-238105890 GGTGGGAGCCAGGAGACAGGAGG - Intronic
1168808383 20:686600-686622 GGTGGAATCCAGGAGATCCCAGG + Intergenic
1169360063 20:4940806-4940828 GGTGGATTCCAGGGACTTGGGGG + Intronic
1170322238 20:15112802-15112824 GGTAGTATCCAGGGGATAGGTGG - Intronic
1170377567 20:15717646-15717668 GGAGCAGGCCAGGAGCTAGGAGG + Intronic
1170777029 20:19384341-19384363 GGTGGTTACCAGGAGCTAGGAGG - Intronic
1170937696 20:20824126-20824148 TCTGGAATCCAGGAGGGAGGTGG + Intergenic
1172841755 20:37906154-37906176 GGTGGAAGGCAGGAGCCCGGCGG - Intronic
1173531520 20:43773134-43773156 GGAGGAATTCAGCAGCAAGGAGG + Intergenic
1173651480 20:44668191-44668213 GCTTGAATCCAGGAGGTGGGAGG + Intergenic
1174178516 20:48659780-48659802 GGTGGATTCTAGGTGGTAGGGGG - Intronic
1175074086 20:56359070-56359092 GGTGGCGCCCAGGAGCCAGGTGG - Exonic
1175237053 20:57521902-57521924 AGTGGTAGCCAGGGGCTAGGAGG + Intronic
1175312782 20:58023628-58023650 GGTGGCACCCAGAAGCTTGGAGG + Intergenic
1176715268 21:10344410-10344432 TGTGGGCTCCAGGACCTAGGTGG + Intergenic
1178415236 21:32399402-32399424 GGTGGTTACCAGGAGCCAGGAGG - Intergenic
1178496028 21:33086960-33086982 GGTGGTTTCCAGGAGCTGGGGGG + Intergenic
1178907529 21:36649055-36649077 GGTGGTTTCCAGGGGCTAGGAGG + Intergenic
1179132730 21:38653015-38653037 CGTGGAATCTAGAATCTAGGCGG - Intronic
1180564841 22:16654284-16654306 CGTGGAAGCCAGGAGGTGGGGGG - Intergenic
1180603081 22:17035544-17035566 TGTGGGCTCCAGGAGCTAGGTGG - Intergenic
1181765648 22:25090037-25090059 GCTGGAGCCCAGGAGCCAGGAGG - Intronic
1182910825 22:33982718-33982740 GCTTGAATCCAGGACCCAGGAGG - Intergenic
1183599059 22:38829569-38829591 GGGGGAATCCAGGAGGATGGTGG - Intronic
1183731895 22:39622823-39622845 GGTGGGAGCCAGGAGCGACGTGG - Intronic
1184580096 22:45411414-45411436 AGTAGATACCAGGAGCTAGGTGG + Intronic
952976437 3:38700265-38700287 GGTGGTTTCCAGGAGCTGGGAGG + Intronic
953202831 3:40792654-40792676 AGTGGAATCCAGGAGCAAGAAGG - Intergenic
953289945 3:41650437-41650459 GGTAGCATCCAGAAGCTTGGAGG - Intronic
953466128 3:43121207-43121229 GGTGGTTTCCAGGAGTTTGGGGG - Intergenic
953507749 3:43502907-43502929 GGCTGTTTCCAGGAGCTAGGTGG + Intronic
953526564 3:43695010-43695032 GGTGGAATACAGGGGCTGGGGGG - Intronic
953717826 3:45331013-45331035 GGTGGACACCAGGAGGGAGGAGG + Intergenic
953857637 3:46512517-46512539 GGTGGTTGCCAGGAGCTTGGAGG - Intergenic
956764555 3:72473419-72473441 GGTGGTTTCCAGAAGCTGGGGGG - Intergenic
957029428 3:75222683-75222705 GATGGAACCCAGGAGGTGGGAGG + Intergenic
959090090 3:101893165-101893187 GGTGGCTGCCAGGAGCTAGGGGG - Intergenic
959111972 3:102133235-102133257 GAGGGTATCCAGGACCTAGGAGG - Intronic
959481610 3:106879512-106879534 GGTGGTTTCCAGGAACTGGGAGG + Intergenic
959755285 3:109890032-109890054 GGTGGGTTCCAGGGGATAGGGGG - Intergenic
960645193 3:119872578-119872600 GATGGAAATCAGGAGGTAGGAGG + Intronic
960996097 3:123341455-123341477 GATGGTTTCCAGGAGCTTGGGGG + Intronic
961269716 3:125679997-125680019 GGTGGAAACCAGGCCCTAGGTGG + Intergenic
961471519 3:127116058-127116080 GGTGGAGTCCAGGAACTCTGGGG - Intergenic
961658346 3:128455386-128455408 GGGGGGCACCAGGAGCTAGGGGG + Intergenic
962486877 3:135852319-135852341 TGTGGAATTCAGGAGCTGGAAGG + Intergenic
962508818 3:136077641-136077663 GCTGCAATCCTGGAGGTAGGAGG - Intronic
962848051 3:139288205-139288227 GGTGGATTGCAGGAGCAGGGAGG - Intronic
964600633 3:158497217-158497239 GGTGGTTGCCAGGGGCTAGGGGG - Intronic
965597504 3:170423038-170423060 GGTGGATTCCAGGACTTAGAAGG - Intronic
967111803 3:186300160-186300182 GATGGAATCAAGGATCAAGGTGG - Intronic
968432449 4:566815-566837 GGTGGGATACAGGAGGTGGGAGG - Intergenic
968945113 4:3659640-3659662 GCTGGAGTCCAGGAGAGAGGTGG - Intergenic
969538483 4:7771022-7771044 ATTGGAATCCAAGGGCTAGGAGG - Intronic
969921856 4:10547654-10547676 GGTGGCTGCCAGGAGCAAGGAGG - Intronic
972135700 4:35890620-35890642 GGTGGAATCCAAGATACAGGTGG - Intergenic
973936428 4:55851242-55851264 GCTTGAACCCAGGAGGTAGGAGG + Intergenic
974481195 4:62445802-62445824 GGTGGATCCCAAGACCTAGGAGG + Intergenic
975075159 4:70197927-70197949 GGTGGAATCCATGAATTAAGTGG - Exonic
975254446 4:72216705-72216727 GGTGGGAGCCAGGAGCAAGCAGG - Intergenic
975576758 4:75870998-75871020 GCTGGAACCCAGGAGGTTGGAGG - Intronic
976321117 4:83717104-83717126 GGTGGGTGCCAGGAGCTGGGAGG - Intergenic
976329065 4:83807422-83807444 GGTGGTTTCCAGGGGCTGGGAGG - Intergenic
977507588 4:97921999-97922021 GGTGGTTTCCAGGAGCTGGAGGG + Intronic
977929660 4:102737213-102737235 AGCAGAATCCAGGAGCTTGGGGG + Intronic
980857255 4:138454832-138454854 GGGGGAATTCAACAGCTAGGGGG - Intergenic
982064017 4:151635707-151635729 GATGGTTTCCAGGAGCTAGGTGG + Intronic
982349119 4:154395471-154395493 GGAGCAATCCAGGAGATAGGAGG - Intronic
982738541 4:159033273-159033295 AGTGGTTGCCAGGAGCTAGGGGG + Intronic
984153015 4:176157979-176158001 GCTGGAGTGCAGGAGCCAGGGGG + Intronic
984729945 4:183058746-183058768 AGTGGTTTCCAGGAGCTAGAGGG - Intergenic
987195033 5:15517708-15517730 GGTGGATTACAGGAGTTAAGGGG + Intronic
987417330 5:17676890-17676912 GGTGGTTTCCAGGCGCTATGTGG - Intergenic
987447098 5:18033653-18033675 AGTGGAACCCAGGAGCAAGATGG + Intergenic
988389925 5:30615232-30615254 GGTGGATACCAGGGGCTGGGAGG - Intergenic
989477523 5:41891312-41891334 GGTGGCTTCCAGGTGATAGGTGG - Intergenic
990540379 5:56766548-56766570 GGTGGTTGCCAGGAGCTAGAGGG - Intergenic
991115987 5:62955384-62955406 GGTAGTCACCAGGAGCTAGGAGG - Intergenic
992236510 5:74715045-74715067 GATGGACTCCAGGAGAGAGGAGG + Intronic
992322538 5:75628198-75628220 GGTAGTTGCCAGGAGCTAGGAGG + Intronic
992587962 5:78260774-78260796 GGTGGTTGCCAGCAGCTAGGGGG - Intronic
992840631 5:80687957-80687979 GGAGGAATTAAAGAGCTAGGTGG + Intronic
995022742 5:107384275-107384297 TGTGGAATCCTGTAGCCAGGAGG - Intronic
995573203 5:113503129-113503151 AATGTCATCCAGGAGCTAGGGGG + Intergenic
996947125 5:129083848-129083870 GATGGTATCCAGAATCTAGGTGG + Intergenic
997343356 5:133164959-133164981 GGTGGCATCCAGGGGCTGGAGGG - Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
998767637 5:145505971-145505993 GGTGGTTTCCAGGGGCTGGGAGG + Intronic
998793448 5:145791550-145791572 GGTGGTTGCCAGGGGCTAGGAGG + Intronic
998951080 5:147393623-147393645 GGTGGGAGCCTGGAGCAAGGTGG - Exonic
999099490 5:149011310-149011332 GATGGAATCCTGGAGTCAGGAGG + Intronic
1002098587 5:176846313-176846335 GGTGGAAGCCAGGTTGTAGGAGG + Intronic
1002326428 5:178411606-178411628 GGTGGTTCCCAGGAGCTGGGAGG + Intronic
1004210812 6:13640719-13640741 GGTGGTTTCCAGGGGCTAGGGGG + Intronic
1006132311 6:31877146-31877168 GGTAGGATCCTGGGGCTAGGAGG - Intronic
1006962433 6:37946855-37946877 GGTGGTTTCCAGGGGCTAGAGGG + Intronic
1008410425 6:51172345-51172367 AGTGGAAGCCAGAAGGTAGGGGG + Intergenic
1011488599 6:87868585-87868607 GAAGGAATCCAGGAGGTTGGTGG - Intergenic
1013340927 6:109214842-109214864 GGTGGTTGCCAGGAGCTGGGAGG - Intergenic
1013814324 6:114079856-114079878 GCTTGAACCCAGGAGGTAGGTGG - Intronic
1013943920 6:115699390-115699412 GGTGGTATCCAGGAGCTGGAAGG - Intergenic
1014248041 6:119088064-119088086 GGTGGTTTCCAGGGGCTAGAAGG + Intronic
1015846421 6:137525043-137525065 GGTGGTTGCCAGGAGCTGGGGGG - Intergenic
1015889795 6:137958938-137958960 GGTGGTTGCCAGGAGCTAGGAGG - Intergenic
1016221314 6:141673779-141673801 AGTGGTTCCCAGGAGCTAGGAGG + Intergenic
1017538989 6:155380493-155380515 GGTGGAATAAAGGAGATAGAGGG + Intergenic
1017603847 6:156112102-156112124 GGTGGAATCCGGCAGCCTGGCGG - Intergenic
1018729172 6:166636129-166636151 GGTGGAGCCCAGGAGCAGGGTGG - Intronic
1019970640 7:4538023-4538045 CGCGTAATCCAGGAGCCAGGTGG - Intergenic
1021465865 7:20943061-20943083 GGTGGTTTCCAGGGGCTTGGGGG + Intergenic
1021990664 7:26138534-26138556 GGTGGTTTCCAGGGGCTAGGAGG - Intergenic
1023104403 7:36749415-36749437 GGTGGTTTCCAGGGGCTTGGGGG + Intergenic
1024502468 7:50125803-50125825 GGTGGTTTCCAGGAGCTGAGGGG + Intronic
1024510576 7:50201215-50201237 GGTGGTTACCAGGAGATAGGGGG + Intergenic
1026357813 7:69574851-69574873 GCTTGAACCCAGGAGCCAGGAGG - Intergenic
1027168505 7:75853250-75853272 GGTGGAATGCAGGAGCCAACTGG + Intronic
1027967782 7:85035562-85035584 GGTGGTTTCCAAGGGCTAGGAGG + Intronic
1029801472 7:102952172-102952194 GGTGGTTGCCAGGACCTAGGAGG + Intronic
1030726684 7:112934608-112934630 GGAGGAATCTAGGAGAAAGGAGG - Intronic
1031824036 7:126540740-126540762 ATTGAATTCCAGGAGCTAGGGGG + Intronic
1032312983 7:130805661-130805683 GGTGGAAGGCAGGAGATTGGAGG + Intergenic
1033383740 7:140850765-140850787 AGTGGTATCCAGGGGTTAGGTGG + Intronic
1033714303 7:143983931-143983953 GGTGGCCTCCAGGAGCTTAGAGG - Intergenic
1034089727 7:148352652-148352674 GGTTGAATCCATGAGCTCAGAGG - Intronic
1034254204 7:149715377-149715399 GGTGGAATCCTGGATCCCGGGGG + Intronic
1034324487 7:150218385-150218407 GGTGAAATCCATTAGCTAGAAGG - Intergenic
1034570993 7:151956303-151956325 GGTGGAATCCAGGAGTTCCAAGG - Intergenic
1034768707 7:153750846-153750868 GGTGAAATCCATTAGCTAGAAGG + Intergenic
1034936796 7:155205039-155205061 GGTGGAATGCAGGAGCAGGCAGG + Intergenic
1035236359 7:157499993-157500015 GGTGGCATCCAGGAGAAGGGGGG - Intergenic
1035485982 7:159226381-159226403 GGTAGAAGCCAGGAGGGAGGTGG + Intergenic
1036019991 8:4833914-4833936 TGTGGAATCAAGGAGGTGGGTGG - Intronic
1037505950 8:19529401-19529423 GTAGGATTCCAGGAGCCAGGAGG - Intronic
1037610053 8:20468502-20468524 GGTGGAATCCAGGCCTTATGGGG - Intergenic
1038304942 8:26391447-26391469 GGTGGAATTCAGGAAACAGGTGG + Intronic
1038427756 8:27475524-27475546 GGTGGGTGCCAGGAGCTAGGGGG + Intronic
1038729370 8:30113493-30113515 GGTGGAATCCAGGAGCAGGAGGG + Intronic
1039066610 8:33614129-33614151 GCTTGAATCCAGGAGGGAGGTGG - Intergenic
1039656570 8:39415348-39415370 GGTGGTTTCCAGGAACCAGGGGG + Intergenic
1040801106 8:51341625-51341647 GGTGGTTGCCAGGGGCTAGGAGG - Intronic
1040862683 8:52015893-52015915 GGGAGAAACCAGGAGCTAAGAGG + Intergenic
1041090965 8:54300312-54300334 GGGGGAAACCGGGAGGTAGGTGG + Intergenic
1044236309 8:89834740-89834762 GGTGGTTTCCAGGAGCTAAGGGG + Intergenic
1044503117 8:92985373-92985395 GGTGGAATCCAGGAGCTAGGAGG - Intronic
1046020167 8:108655617-108655639 CCTGGAATCCAGCAGCTTGGGGG - Intronic
1047356649 8:124128536-124128558 GGTGATTTCCAGGGGCTAGGGGG - Intergenic
1047430402 8:124786238-124786260 GGTGGTTACCAGGAGCTGGGGGG + Intergenic
1047556172 8:125933044-125933066 GGTGGCTTCCAGGGGCTGGGAGG + Intergenic
1048020234 8:130531646-130531668 GGTGGTTTCCAGGGGCTGGGAGG - Intergenic
1048933104 8:139332118-139332140 GGTGGCTTCCAGGAGCTAGAAGG + Intergenic
1048956607 8:139542809-139542831 GGTGGAAGCCAGGGGCCAGCAGG + Intergenic
1049162599 8:141106790-141106812 GGGGGTTGCCAGGAGCTAGGGGG - Intergenic
1049600998 8:143507652-143507674 GGTAGAATCCAAGGGCCAGGGGG - Intronic
1052672850 9:31580521-31580543 GGTGAAGTCCAGGAGAAAGGAGG + Intergenic
1053176945 9:35932946-35932968 GGTGGTTACCAGGGGCTAGGGGG - Intergenic
1053265884 9:36713136-36713158 GGTGGTTACCAGGAGCTGGGAGG - Intergenic
1053573521 9:39334423-39334445 AGTGGTTTCCAGGAGTTAGGAGG - Intergenic
1053838141 9:42162982-42163004 AGTGGTTTCCAGGAGTTAGGAGG - Intergenic
1054095089 9:60893107-60893129 AGTGGTTTCCAGGAGTTAGGAGG - Intergenic
1054116557 9:61169033-61169055 AGTGGTTTCCAGGAGTTAGGAGG - Intergenic
1054123623 9:61284586-61284608 AGTGGTTTCCAGGAGTTAGGAGG + Intergenic
1054591201 9:67013527-67013549 AGTGGTTTCCAGGAGTTAGGAGG + Intergenic
1054805710 9:69394141-69394163 GATGGACACCAGGAGCAAGGGGG + Intergenic
1055839304 9:80483158-80483180 GGTGGAGTCCAAGAGCTAGTGGG - Intergenic
1055954435 9:81760996-81761018 GGTGTGTTCCAGGAGCAAGGAGG - Intergenic
1058406751 9:104685058-104685080 GATGGTTTCCAGGGGCTAGGTGG + Intergenic
1058949638 9:109891569-109891591 GCTTGAATCCAGGAGATGGGAGG - Intronic
1059003677 9:110377879-110377901 GGTGGTTCCCAGGAGCTGGGAGG - Intronic
1059479557 9:114578114-114578136 GGTGGTTGCCAGGAGCAAGGCGG - Intergenic
1059649473 9:116302391-116302413 GGTGGTTTCCAGGATCTCGGGGG - Intronic
1060621627 9:125072700-125072722 GGTGGCTGCCAGGGGCTAGGAGG - Intronic
1061431306 9:130533015-130533037 GGAGGAAGACAGGAGCCAGGAGG + Intergenic
1185870342 X:3659473-3659495 GCAGGAATCCAGCAGCAAGGTGG - Intronic
1185986145 X:4836557-4836579 GGTGGTTGCCAGGAGCTGGGGGG - Intergenic
1186167322 X:6840574-6840596 GGTGTATTCCAGGAGTTAGTGGG + Intergenic
1186300523 X:8195664-8195686 GGTGAAATCAAGGTGCTAGCTGG + Intergenic
1186538020 X:10369815-10369837 GGTGGTTGTCAGGAGCTAGGGGG + Intergenic
1187592135 X:20729132-20729154 GGTGACTGCCAGGAGCTAGGTGG + Intergenic
1187909659 X:24099499-24099521 GGTGGTTCCCAGGAGCTAAGAGG - Intergenic
1188488734 X:30713176-30713198 GCTTGAAGCCAGGAGCTAGGTGG - Intronic
1188679713 X:32987414-32987436 ACTGGAATCCAGGAGCCAGATGG + Intronic
1189179559 X:38990615-38990637 GGTGGTTCCCAGGAGCTGGGAGG + Intergenic
1190382228 X:49850624-49850646 GGTGGCTTCCAGGGGCTAGGGGG + Intergenic
1192386344 X:70675509-70675531 GGTGGTTTCCAGGGGCTAGGAGG - Intronic
1192568596 X:72183836-72183858 AATGGAATCCAGGACCTAGGGGG + Intronic
1193883279 X:86953196-86953218 GGTGGTTTCCAGGTGCTAGCAGG + Intergenic
1193948810 X:87772659-87772681 GGTGGTTGCCAGGAGCTATGGGG - Intergenic
1194816873 X:98453012-98453034 GGTGGTTTCCAGGGGCTGGGGGG - Intergenic
1194967135 X:100301236-100301258 GGTGGAATAGAAGAGCTAAGAGG + Intronic
1195520709 X:105824692-105824714 GGTGGAGCCCAGGAGATAAGAGG + Intronic
1196023920 X:111020375-111020397 GGTGGTTTCCAGGAGCTGAGAGG + Intronic
1197742483 X:129905925-129905947 CGTGGAAACCAGGGGCCAGGAGG + Intergenic
1197839778 X:130733773-130733795 GGTGGAAGGCAGGAGGGAGGTGG + Intronic
1197921576 X:131599901-131599923 GGTGGTTACCAGGAGCTAAGGGG - Intergenic
1198174640 X:134143460-134143482 GGTGGAGTACAGGTGCTAAGAGG + Intergenic
1198183125 X:134229450-134229472 AGTGGAAGGCAGGAGTTAGGAGG - Intergenic
1198792618 X:140362104-140362126 GGTGGTTGCCAGGAGCTAGGGGG + Intergenic
1201224685 Y:11807451-11807473 GGTGGTTACCAGGAGCTGGGAGG + Intergenic