ID: 1044504980

View in Genome Browser
Species Human (GRCh38)
Location 8:93006734-93006756
Sequence AGAGGCAGTCTGGCCAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044504980_1044504986 15 Left 1044504980 8:93006734-93006756 CCCATCTTGGCCAGACTGCCTCT 0: 1
1: 0
2: 5
3: 20
4: 213
Right 1044504986 8:93006772-93006794 ACTCCTCCCTCTTCACTGTGTGG No data
1044504980_1044504988 17 Left 1044504980 8:93006734-93006756 CCCATCTTGGCCAGACTGCCTCT 0: 1
1: 0
2: 5
3: 20
4: 213
Right 1044504988 8:93006774-93006796 TCCTCCCTCTTCACTGTGTGGGG No data
1044504980_1044504987 16 Left 1044504980 8:93006734-93006756 CCCATCTTGGCCAGACTGCCTCT 0: 1
1: 0
2: 5
3: 20
4: 213
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044504980 Original CRISPR AGAGGCAGTCTGGCCAAGAT GGG (reversed) Intronic
900782563 1:4627578-4627600 AGAGCCAGTGTGGACAACATCGG + Intergenic
903179724 1:21599096-21599118 AGAGCCAGCCTGGCAAAGAAAGG + Intronic
903225272 1:21890973-21890995 AGAGGAAGGCTGGACAAGAAGGG + Intronic
903629891 1:24760163-24760185 TGAGACAGCCTGGCCAACATGGG + Intronic
905365414 1:37448596-37448618 AGAGGCAGTCCGGGCAAGGGCGG - Intergenic
906781607 1:48577640-48577662 AGAGGCAGTCAGCCCAAGGCAGG + Intronic
912322521 1:108727641-108727663 AGTGGCAATTAGGCCAAGATTGG + Intronic
913446041 1:118951782-118951804 AGAAGCAGTGAGGCCCAGATAGG - Intronic
914874696 1:151504190-151504212 AGGAGCAGCCTGGCCAACATAGG + Intergenic
916934091 1:169609854-169609876 AGAGTGAGTCAGGCCAAGAGGGG - Intronic
919166771 1:193905520-193905542 AGAAGCAGGATGGCCAGGATTGG + Intergenic
919746697 1:201013433-201013455 AGAAGCAGTGTGGCAAGGATGGG + Intronic
924642201 1:245844827-245844849 AGAGGCAGTCTGTCTGTGATTGG - Intronic
1062943256 10:1439781-1439803 AGAGGCAGTCTCCTCATGATGGG + Intronic
1066345559 10:34581782-34581804 AGAGGCAGTCTGGGAAAGAAGGG + Intronic
1067216876 10:44310832-44310854 AGAGGCAGGCAGGCCAGGAGCGG + Intergenic
1067231079 10:44411170-44411192 AGAGGCAGTCTGTCCATTATTGG + Intergenic
1070641289 10:78172142-78172164 GCAGGCAGTCTGGCAAACATAGG - Intergenic
1073328524 10:102656460-102656482 AGAGGCAGTGTGGCCCAGTCTGG + Intronic
1075028784 10:119006653-119006675 AGAGACAGTCTGGGCAGAATTGG + Intergenic
1075359884 10:121821679-121821701 AAGGGCAGCCTGGCCAATATGGG + Intronic
1075376431 10:121981404-121981426 AGAAGTAGGCAGGCCAAGATTGG + Intergenic
1077655635 11:4016520-4016542 GGAGGCAGTCTGTCCATTATCGG + Intronic
1078569853 11:12448290-12448312 AGATGCAGCCTGGCCAGCATGGG + Intronic
1079445699 11:20554534-20554556 AGAGGCTCCCTGGCCAACATAGG + Intergenic
1079752132 11:24212840-24212862 AGAAGCAGTCTGGCCACAAATGG - Intergenic
1080011595 11:27465117-27465139 GGAGGCAGCTGGGCCAAGATTGG - Intronic
1081851741 11:46278770-46278792 AGAGGCGGTCAGGGCAACATAGG + Intronic
1084307966 11:68299030-68299052 AGAGGCTGTAGGGGCAAGATCGG - Intergenic
1084948600 11:72652405-72652427 AGAAGCAGCCAGGCCAAGCTGGG - Intronic
1086505321 11:87498118-87498140 AGAGGCAGTCTGGCTACAGTGGG - Intergenic
1090593193 11:128293753-128293775 ACAGGCAGCCTGGACAAAATTGG - Intergenic
1091602197 12:1924720-1924742 AGAGGCGGTCTGCCAAAGAGTGG + Intergenic
1093110672 12:15148280-15148302 CTAGGCAGACTGGCCATGATGGG + Intronic
1095073867 12:37893068-37893090 AGAGGCAGTCTGCCCATTCTCGG - Intergenic
1098169794 12:67736016-67736038 AGAGCCAGCCTTGCCAATATTGG + Intergenic
1098858335 12:75679571-75679593 ATAGACAGACAGGCCAAGATAGG - Intergenic
1098952795 12:76659167-76659189 AGGACCAGCCTGGCCAAGATGGG + Intergenic
1099146226 12:79046071-79046093 AGAGGCAGTCAGGCAAACCTAGG + Intronic
1099588070 12:84546523-84546545 AGATGCAGTCTGGCGGGGATTGG + Intergenic
1100652337 12:96604427-96604449 GGAGGCAGTCTGTCCATTATCGG + Intronic
1101584346 12:106071473-106071495 AGAGGCTGTCTGCCTAAGACGGG - Intronic
1102336992 12:112090029-112090051 AGAGACAGCCCGGCCAACATAGG - Intronic
1103734446 12:123050359-123050381 AGAAGCAGTCAGGGCAAGATGGG + Intronic
1106763136 13:32887374-32887396 AGGGGGAGCCTGGGCAAGATAGG - Intergenic
1109328673 13:60900760-60900782 AGAGGCAGTCTGGCTACAGTGGG - Intergenic
1111183080 13:84694190-84694212 AGAAGCAGTCTGGCCATAATCGG - Intergenic
1112076166 13:95915778-95915800 AGAAGCAGTCTGGCCATGATCGG - Intronic
1113458625 13:110466390-110466412 CGAGGATGTCAGGCCAAGATGGG + Intronic
1116236447 14:42285094-42285116 AGAGGCAGTCTGTCCGTTATTGG + Intergenic
1116265133 14:42678644-42678666 AGAAGCAGTTTTGCCAAGCTTGG + Intergenic
1119391252 14:74292634-74292656 AAAGGCATTCTGGACAGGATGGG + Exonic
1120735545 14:88047974-88047996 AGAGGGTGCCTGGCCAAGCTGGG - Intergenic
1121868379 14:97384175-97384197 GGAGGCAGGCAGGCCAGGATTGG - Intergenic
1123885086 15:24718588-24718610 AGAAGCAGTCTGGCCACGATTGG + Intergenic
1123919179 15:25058509-25058531 ACAGGCAGTCTGCCCAACCTAGG - Intergenic
1124690971 15:31822548-31822570 AGAGGCAGGGTGGCCAGGCTGGG - Intronic
1124869570 15:33527378-33527400 CGAGACAGCCTGGCCAACATGGG + Intronic
1125893768 15:43285330-43285352 AGACTCAGCCTGGCCAACATGGG + Intronic
1126742124 15:51787525-51787547 AGAGGCAGTCTGTCCGTTATCGG - Intronic
1128477936 15:68013295-68013317 AGAGTCAGTTTCTCCAAGATAGG + Intergenic
1129367266 15:75063982-75064004 AGTGGGACTCTGGCCAAGAGGGG + Intronic
1129878768 15:78993807-78993829 AGAGGCATTCTGGCCAAGGTGGG + Intronic
1129926849 15:79372153-79372175 AGTGGCAGTTTCACCAAGATAGG + Intronic
1130299401 15:82668380-82668402 AGATGGTGTCTGGCCAAGAGAGG - Intronic
1131425489 15:92342312-92342334 TGAGACAGCCTGGCCAACATGGG + Intergenic
1132913615 16:2329511-2329533 ACTGGAAGTCTGGCCAAGAAAGG + Intronic
1139922097 16:70467018-70467040 AGAGGCAGGGTGGGCAAGAAGGG - Intronic
1141340320 16:83197618-83197640 AGAGGCAGTCTCTGCAAGAGAGG + Intronic
1141360630 16:83392171-83392193 TGAGGCAGTGGGGCCAGGATGGG - Intronic
1141837593 16:86552842-86552864 AGAGGCAGTCCTGACAAAATGGG + Intronic
1142759212 17:2033693-2033715 AGAGGTTGCCTGGCCCAGATGGG + Intronic
1143363158 17:6387765-6387787 AGAGGGAGCCTGGCCAAGTCTGG + Intergenic
1143521050 17:7444652-7444674 AGGGGCAGCCTGGAAAAGATGGG + Exonic
1143818544 17:9540613-9540635 ACATGGAGTCTGGCCAAGAGCGG - Intronic
1144955948 17:19018904-19018926 GAAGTCAGTCTGGCCCAGATCGG + Intronic
1145861254 17:28212228-28212250 GGAGGCAGTCTGTCCATTATTGG - Intergenic
1148638758 17:49169281-49169303 AGAGGCAGAGTGGCACAGATTGG - Intronic
1148939550 17:51196468-51196490 GGGGGCAGCCTGGCCAAGGTGGG - Intronic
1151618843 17:75232633-75232655 AGAGCCAGTCTTGCCGTGATGGG + Intronic
1153495772 18:5697119-5697141 ACAGACAGACTGGCCAAAATGGG - Intergenic
1155918390 18:31578219-31578241 AGAAGCAGTCTGGCTCAGTTGGG + Intergenic
1156683038 18:39614279-39614301 AGAGGAAGCCTGGATAAGATGGG - Intergenic
1156842677 18:41628005-41628027 AGGGACAGCCTGGCCAAGCTTGG - Intergenic
1157058208 18:44255733-44255755 GGAGGCAGTCTGTCCATTATCGG + Intergenic
1157067877 18:44373541-44373563 ACAGGCAGTCTGGACAAGGAAGG - Intergenic
1157215517 18:45780091-45780113 AGAGGCAGACTAGCTAATATGGG - Intergenic
1157413265 18:47481574-47481596 TGGGCCAGTCTGGCCAAGGTGGG + Intergenic
1158067009 18:53422693-53422715 TGAGGCAGTCTAGTCAAGCTTGG + Intronic
1159095173 18:63894047-63894069 TGAGGCAGTTTGGCCTGGATGGG - Intronic
1161405357 19:4088445-4088467 AGGGGCAGTCTGGGCTAGGTGGG - Intergenic
1164415227 19:28041523-28041545 AGATGGACTCTGGCCAAGGTAGG + Intergenic
1164852005 19:31491823-31491845 AGAGGCAGCCATGCCAAGACGGG - Intergenic
1166666913 19:44685657-44685679 AGAATCAGCCTGGCCAAGATGGG + Intergenic
1167052212 19:47086289-47086311 AGAGGCTGTGAGGCCAAGGTAGG - Intronic
1167096758 19:47378628-47378650 AAAGGCAGCCTGGGCAACATAGG + Intronic
1168649257 19:58082866-58082888 AAAAGCAGCCTGGCCAACATGGG - Intronic
925424120 2:3734657-3734679 ACAGGCAGCCTGGACAAGACTGG + Intronic
928940948 2:36726858-36726880 AGAGGCTGTCTGGGAAAGAAAGG + Intronic
928940995 2:36727210-36727232 AGAGGCTGTCTGGGAAAGAAAGG - Intronic
929881724 2:45842727-45842749 GGAGGCAGTTTTGCCATGATTGG - Intronic
933511850 2:83249724-83249746 AAAGGCAGACTGGGCAAGAAGGG + Intergenic
935159061 2:100513264-100513286 AGAGGCAGACAGGCTAAGAGAGG - Intergenic
935216732 2:100980836-100980858 AAAGCCACTCTGGTCAAGATGGG + Intronic
935765198 2:106359649-106359671 GGAGGCAGTGTGGCCAGCATCGG - Intergenic
937701100 2:124863759-124863781 ATTGGCAGTCTGGGAAAGATGGG + Intronic
938160930 2:128983775-128983797 AGAGGCAGCCTTGCCATGAGGGG + Intergenic
939818213 2:146922566-146922588 CGAGACAGCCTGGCCAACATGGG - Intergenic
942094480 2:172524380-172524402 AGGGGCACTCTGGCCAAATTTGG + Intergenic
942385928 2:175442768-175442790 AGAATCAGTCTGGCCAGGCTAGG - Intergenic
943409816 2:187532988-187533010 AGAGGCAGTCTGGCTACAGTGGG - Intronic
943811570 2:192194982-192195004 AGAGGCAGTCGGGCTCTGATTGG + Exonic
943953989 2:194162657-194162679 AGTGGGACTCTGGCCAAGAAGGG - Intergenic
947310856 2:228800187-228800209 AGAGGAGGTGTGGCCAAGAATGG + Intergenic
947746949 2:232512703-232512725 AGAGGCAGCCTGGCCAGGCAGGG - Intergenic
948378742 2:237539014-237539036 GGAGACAGCCCGGCCAAGATGGG + Intronic
1170157048 20:13278521-13278543 AGAGACAGTGTGGCAAAGTTAGG + Intronic
1172752306 20:37259351-37259373 AGAGGCAGCCTGGACCAGGTGGG - Intronic
1173479584 20:43388664-43388686 AGAGGCATTCTGCCCAAGGAGGG + Intergenic
1175040970 20:56050304-56050326 AGAGGCAGTCTGGCTACAGTGGG - Intergenic
1175539113 20:59737142-59737164 AGGGGCAGGCTGTCCAAGACAGG - Intronic
1176041426 20:63067902-63067924 AGGGGCAGTGTGGCCAGGACTGG + Intergenic
1176242624 20:64082181-64082203 GGAGGCAGTCTGTCCAGGAGTGG - Intronic
1178047272 21:28709681-28709703 AGGGTCAGTCTGGCAAAGGTGGG - Intergenic
1178510096 21:33197888-33197910 AGAGGATGGCTGGCAAAGATAGG - Intergenic
1181093794 22:20492476-20492498 AGAGACAGAATGGCCTAGATGGG - Intronic
1181715062 22:24719856-24719878 TGAGTCAGTCTGTGCAAGATGGG - Exonic
1182094434 22:27616429-27616451 AGAGGCACTCGTGCCCAGATTGG + Intergenic
1182350715 22:29697854-29697876 GGACGCAGTCTGGCCAAGCGCGG - Exonic
1184837314 22:47031665-47031687 GGAGGCAGGCGAGCCAAGATGGG - Intronic
949804215 3:7936401-7936423 AGACACAGACTGGCAAAGATGGG + Intergenic
950525288 3:13519505-13519527 AGAGGCAGCCAGGCTGAGATTGG + Intergenic
950642757 3:14359154-14359176 AGATGCATTCTGCCCAAGAAAGG + Intergenic
952352440 3:32553132-32553154 AAGGCCAGTCTGGTCAAGATAGG + Intronic
953466169 3:43121636-43121658 AGTGGAAGTGTGGCAAAGATAGG - Intergenic
953811721 3:46118153-46118175 AGTGGGACTCTGGCCAAGAGGGG - Intergenic
957268860 3:78003200-78003222 AGAGGCACTCTGGCCACAGTTGG + Intergenic
959584654 3:108014898-108014920 CGTGCCAGTCTGGCCAAGAGTGG - Intergenic
959883534 3:111473650-111473672 ATAGGCAGTCTGGCCATAATCGG + Intronic
960333226 3:116388110-116388132 AGGGGCATTTTGGCCAAGAAAGG + Intronic
961006188 3:123406862-123406884 AGTGGCAGCCTGGCCAAGGAAGG - Intronic
961582399 3:127893286-127893308 AGAGGGAGTAAGGGCAAGATAGG + Intergenic
961848948 3:129795299-129795321 AGAGGAAGAGTGGCAAAGATAGG - Intronic
962629453 3:137260962-137260984 AAAGGCATTCTGGCCATGATTGG + Intergenic
963533886 3:146503992-146504014 AGTGGGTGTCTGGCCAAGCTGGG - Intergenic
967860258 3:194145848-194145870 AGGGGCAAACTGGCCCAGATTGG + Intergenic
968246210 3:197151841-197151863 AAAACCAGTCTGGCCAACATGGG + Intronic
973970677 4:56211342-56211364 GGAGGCAGTATGGCCAAGCTAGG - Intronic
974062821 4:57051152-57051174 GAAGGCACTATGGCCAAGATGGG + Intronic
975057122 4:69947953-69947975 CGAGGCAGCCTGGCTAAAATGGG + Intergenic
975524271 4:75331726-75331748 AGAGGCAGTCTGGCTACTGTGGG - Intergenic
976552541 4:86413378-86413400 GGAGGCAGTCTGTCCAATCTTGG + Intronic
977192615 4:94019588-94019610 CCAGGCAGTGTGGCCAAAATAGG - Intergenic
978967041 4:114752886-114752908 AAAGCCAATGTGGCCAAGATGGG - Intergenic
980803602 4:137784315-137784337 GGAGGCAGTCTGTCCATTATTGG - Intergenic
981806766 4:148725008-148725030 AGACCCAGTCTGGGCAACATAGG - Intergenic
982870176 4:160569715-160569737 AGTGGCATTCTGGCCGGGATAGG - Intergenic
984505933 4:180618751-180618773 GGAGACAGTTTGGCCAAGAAAGG - Intergenic
986149571 5:5115138-5115160 GGAGGCAGTCTGTCCATTATGGG + Intergenic
986878460 5:12139917-12139939 AGAGGCAGTCAGACCCAAATTGG + Intergenic
986956988 5:13164166-13164188 ATAGGCAGGCAGACCAAGATAGG - Intergenic
987445031 5:18006681-18006703 GGAGGCAGTCTGTCCATTATTGG - Intergenic
990042546 5:51390729-51390751 CTTGGCAGGCTGGCCAAGATTGG + Intronic
990695474 5:58411822-58411844 AGAGGCAGGCAGCCCAGGATTGG + Intergenic
990898966 5:60729513-60729535 GGAGGCAGTCTGTCCATTATTGG - Intergenic
991154504 5:63415482-63415504 AGAGGGAGTCTGGCTTAGATAGG - Intergenic
991421882 5:66450575-66450597 AAAAGCTGGCTGGCCAAGATCGG - Intergenic
992101804 5:73415345-73415367 AGAGGCCACCTGGCAAAGATTGG - Intergenic
993984700 5:94583699-94583721 GGAGGCAGTCTGTCCATTATTGG - Intronic
995258253 5:110072439-110072461 CTAGGCAGTCTGGACAAGAGGGG - Intergenic
995270533 5:110215452-110215474 AGACACAGACTGGCAAAGATTGG - Intergenic
997612504 5:135224977-135224999 AGAGGCAGGCTGGGGAAGAATGG - Intronic
997763209 5:136470915-136470937 ATTGTCAGTCTTGCCAAGATAGG + Intergenic
999049722 5:148509497-148509519 AGGGACAGTCTGGCCCAGAATGG + Exonic
999797290 5:155000695-155000717 AGACCCAGCCTGGCCAACATGGG - Intergenic
1002390388 5:178907067-178907089 TGAGGCAGTCTGGCCAAAGCTGG + Intronic
1005391225 6:25335640-25335662 AGAGGCTGTCTGTACAAGAAGGG + Intronic
1006244692 6:32721063-32721085 AGAGGCATTCTGGTAAAGTTTGG + Intergenic
1006414816 6:33897234-33897256 GGAGGCACTTTGGCCAGGATGGG + Intergenic
1007794750 6:44338516-44338538 AGAAGAAGCCTGGCAAAGATAGG - Intronic
1007926276 6:45651989-45652011 AGAGACAGTCTGGCGAGGAGCGG - Intronic
1007961982 6:45968212-45968234 AGAGGCATGCTGGCCAAGAGTGG - Intronic
1010262377 6:73831453-73831475 TGAGGAATTCTGGCCAAGAATGG + Intergenic
1015197151 6:130536670-130536692 AGAAGCAGTCTGGCCATGCTTGG - Intergenic
1017599448 6:156064704-156064726 AAAGGCAGGCTGGCCAGCATGGG + Intergenic
1017688195 6:156934721-156934743 AAAGGCAGTTTGACCAAAATCGG + Intronic
1017836480 6:158183352-158183374 AGAGGCAGTCTATCCATTATCGG + Intronic
1020161131 7:5772583-5772605 AGAGGCAGTAAGCCCCAGATCGG + Intronic
1020527164 7:9276452-9276474 AGAACCACTCTGGCCAACATGGG - Intergenic
1024363949 7:48500126-48500148 AGAGGAAGTGTAGCCAAGGTTGG - Intronic
1027262864 7:76477390-76477412 AGAGGCAGGGAGGCCAAGATGGG + Intronic
1027314246 7:76975499-76975521 AGAGGCAGGGAGGCCAAGATGGG + Intergenic
1027701827 7:81479129-81479151 GGAGGCAGTCTGTCCATTATTGG - Intergenic
1028340981 7:89719371-89719393 GGAGGCAGTCTGTCCATTATTGG - Intergenic
1028611982 7:92721623-92721645 GGAGGCAGCCTGGCAAAGTTAGG + Intronic
1029650009 7:101885237-101885259 AGAGGCTCTCTGGCCAGGAGGGG + Intronic
1030318842 7:108143621-108143643 AGACCCAGCCTGGCCAACATGGG + Intergenic
1030920872 7:115384611-115384633 AGAGTAAGTCTGGACAAGGTAGG + Intergenic
1031591225 7:123594755-123594777 GGAGGCAGTCTGTCCATTATTGG + Intronic
1031987145 7:128170537-128170559 ATGGGAAGGCTGGCCAAGATCGG + Intergenic
1034699830 7:153086365-153086387 AGAGGGAGTATGGCAGAGATGGG + Intergenic
1036547826 8:9789305-9789327 TGAGGCAGTCTGGGCAACATGGG + Intergenic
1037334134 8:17775792-17775814 TGAGGCAGCCTGGCCAACCTGGG + Intronic
1038768033 8:30448474-30448496 AGAGGCAACCTAGTCAAGATGGG - Intronic
1039786467 8:40838649-40838671 AGAGTCAGTCTGGCCATGGTAGG - Intronic
1040900879 8:52415741-52415763 AGAGGCAGCCTGGCCACTAAGGG - Intronic
1041211845 8:55559710-55559732 AGAGGCACTATGGCCAAAGTCGG + Intergenic
1041487320 8:58393188-58393210 AGAACCAGACTGGCCAAGCTTGG + Intergenic
1042168093 8:65965923-65965945 AGAGTCAGGCTGGCCCAAATTGG + Intergenic
1043233325 8:77830296-77830318 AGAGGCACTCTGGCCACAGTCGG - Intergenic
1044504980 8:93006734-93006756 AGAGGCAGTCTGGCCAAGATGGG - Intronic
1045585077 8:103525499-103525521 AGAGGCAGTCCGGCCTAGCTTGG + Intronic
1046947450 8:119987734-119987756 AGAGGCAGCCTGGCTACAATGGG + Intronic
1047204912 8:122795336-122795358 GCAGGCAGGTTGGCCAAGATAGG - Intronic
1048914093 8:139165390-139165412 CGAGGCAGTCTGGCCATGATGGG + Intergenic
1049124258 8:140772413-140772435 AGACCCTGTCTCGCCAAGATGGG + Intronic
1050597350 9:7216928-7216950 GGAGGCAGTCTGTCCATTATCGG - Intergenic
1054961551 9:70975716-70975738 AGAGGAAGGCTGGCCAAGATAGG - Intronic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1057307214 9:93919379-93919401 AAAGGCCGCCTGGCCAAGTTGGG - Intergenic
1061144156 9:128787408-128787430 AGGGGCAGCCTGGCCAGGAGTGG - Intronic
1061647719 9:132019338-132019360 GGAGGCAGTCTGTTCTAGATTGG - Intronic
1061972625 9:134053174-134053196 AGAGGCAGTCTTTCCAGGATGGG + Intronic
1186418168 X:9401397-9401419 AGAGACACTCTGGCCAACAATGG - Intergenic
1186567357 X:10677693-10677715 AGAGGCAGCCTGCCCCAGTTTGG - Intronic
1186683290 X:11898159-11898181 AGAGGCAGTCAGGGCTGGATGGG + Intergenic
1187326318 X:18294326-18294348 ACAGCCAGTTTGGCCAAGACTGG + Intronic
1187749386 X:22445237-22445259 AGAGGATGTCTGTCCAAGAGAGG + Intergenic
1189738206 X:44092684-44092706 GCAGGCAGTCTGGCCTAGACAGG - Intergenic
1190142626 X:47861593-47861615 AGCAGCAGTCTGGCCAATACTGG + Intronic
1191043796 X:56114126-56114148 AGAAGCAGTCTGTCCATGATTGG + Intergenic
1192113972 X:68393233-68393255 AGAGGCAGTGTTGCCCAGACTGG - Intronic
1196369182 X:114956727-114956749 ATAGGCAGGTTGGCCAAGAAGGG + Intergenic
1198105852 X:133460477-133460499 AAAAACAGCCTGGCCAAGATGGG + Intergenic
1198572398 X:137971639-137971661 CGAGGCAGTCTGTCCATTATTGG - Intergenic
1198797668 X:140416224-140416246 ACAGGCAGGCAGGCCAAGGTAGG - Intergenic
1199475091 X:148236197-148236219 AGAGCCAGTCATGCAAAGATGGG - Intergenic
1202299056 Y:23391479-23391501 AGAGGCTGTCTGTCCAAGAGAGG + Intergenic
1202571753 Y:26279119-26279141 AGAGGCTGTCTGTCCAAGAGAGG - Intergenic