ID: 1044504981

View in Genome Browser
Species Human (GRCh38)
Location 8:93006735-93006757
Sequence AAGAGGCAGTCTGGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 519}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044504981_1044504988 16 Left 1044504981 8:93006735-93006757 CCATCTTGGCCAGACTGCCTCTT 0: 1
1: 0
2: 2
3: 41
4: 519
Right 1044504988 8:93006774-93006796 TCCTCCCTCTTCACTGTGTGGGG No data
1044504981_1044504986 14 Left 1044504981 8:93006735-93006757 CCATCTTGGCCAGACTGCCTCTT 0: 1
1: 0
2: 2
3: 41
4: 519
Right 1044504986 8:93006772-93006794 ACTCCTCCCTCTTCACTGTGTGG No data
1044504981_1044504987 15 Left 1044504981 8:93006735-93006757 CCATCTTGGCCAGACTGCCTCTT 0: 1
1: 0
2: 2
3: 41
4: 519
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044504981 Original CRISPR AAGAGGCAGTCTGGCCAAGA TGG (reversed) Intronic
901203574 1:7481031-7481053 AAGAGGCAGTGAGGGAAAGAGGG - Intronic
902168902 1:14594942-14594964 CAAGAGCAGTCTGGCCAAGATGG + Intergenic
902357576 1:15916711-15916733 AAGAGCCAGCCTGGGCAACATGG - Intronic
902609881 1:17590784-17590806 AAGACCCAGCCTGGCCAACATGG + Intronic
903225271 1:21890972-21890994 CAGAGGAAGGCTGGACAAGAAGG + Intronic
903291442 1:22316699-22316721 TCGAGACAGCCTGGCCAAGATGG + Intergenic
903566890 1:24274466-24274488 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
903672137 1:25042878-25042900 AAGAGGCAGACAGGCCAGGGAGG - Intergenic
903841876 1:26248694-26248716 AAGACCCAGACTGGCCAACATGG - Intronic
904241550 1:29149477-29149499 AAGAGCCAGCCTGGCCAACATGG + Intronic
904277676 1:29394884-29394906 AAAAGGCAGTGGGGCCAGGAGGG + Intergenic
904508737 1:30983192-30983214 AGGAGGCAGTCCACCCAAGAGGG + Intronic
905783865 1:40736923-40736945 TTGAGGCAGCCTGGCCAACATGG + Intronic
906631461 1:47372291-47372313 AAGAACCAGCCCGGCCAAGATGG - Intronic
906843068 1:49160766-49160788 GAGAGGCAGTCTGGCCACAGCGG + Intronic
907728891 1:57046910-57046932 CAGAGGCAGTTTGGCCCAGCAGG + Intronic
909047645 1:70729256-70729278 AAGAGGCAGTCTGGAGAAAATGG - Intergenic
909640136 1:77863229-77863251 AACAGGCACTTAGGCCAAGAGGG - Intronic
910566895 1:88653881-88653903 AAGAACCAGCCTGGCCAACATGG + Intergenic
911611850 1:99967021-99967043 AAGAGGCAGGCTGGGCACGGTGG + Intergenic
912491415 1:110064779-110064801 AAGATGCAGGCTGGCCAGGCAGG + Exonic
914967107 1:152269865-152269887 GAGAGGCAGTCTGGCCACAGCGG + Intergenic
914969260 1:152292252-152292274 GAGAGGCAGTCTGGCCACAGCGG - Intergenic
915506954 1:156363719-156363741 AGGGGGCAGCCTGGCCAACATGG - Intronic
916488235 1:165278409-165278431 AAGAGGAAAGCTGTCCAAGAGGG - Intronic
916896320 1:169166768-169166790 AGGAGACAGCCTGGCCAACATGG + Intronic
916934092 1:169609855-169609877 GAGAGTGAGTCAGGCCAAGAGGG - Intronic
918906778 1:190506097-190506119 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
919461640 1:197884234-197884256 GAGAGGCAGTCTGGCCACAGCGG + Intergenic
919746696 1:201013432-201013454 AAGAAGCAGTGTGGCAAGGATGG + Intronic
920091534 1:203456497-203456519 CAGAGGCAGCCTTGCTAAGAAGG + Intergenic
920130856 1:203730768-203730790 ATGAGGCAGTTGGGCCAAAATGG + Intronic
921224041 1:212999072-212999094 CAAGAGCAGTCTGGCCAAGATGG - Intronic
921402663 1:214743410-214743432 GAGAGACAGCTTGGCCAAGATGG + Intergenic
921890582 1:220349407-220349429 AAGAGTAAGCCTGGCAAAGATGG + Intergenic
922155287 1:223036284-223036306 AGGGGACAGTGTGGCCAAGATGG + Intergenic
922575637 1:226659226-226659248 AAGAGGAAGAGTGGCCATGATGG - Intronic
922606660 1:226893928-226893950 AAGAGAAACTCTGGCCCAGAAGG - Intronic
922708407 1:227806194-227806216 AAGACCCAGCCTGGCCAACATGG + Intergenic
923551360 1:234966903-234966925 AAGACCCAGCCTGGCCAACATGG + Intergenic
923712886 1:236400995-236401017 AAGAACCAGGCTGGCCAACATGG + Intronic
923955313 1:239011515-239011537 AAGATCCAGTCTGGCCAGGGAGG - Intergenic
924296045 1:242587374-242587396 GAGAGGCAGTCTGGCCACAGAGG - Intergenic
924828984 1:247572886-247572908 GAGAGGCAGTCTGGCCACAGTGG + Intronic
1063479676 10:6363887-6363909 AAGAGTCAGTCAGTCAAAGAAGG + Intergenic
1064054920 10:12089178-12089200 AGGCAGCAGTCTCGCCAAGACGG + Exonic
1064377920 10:14813870-14813892 AAGACCCAGTCTGGCCGACATGG + Intergenic
1065060312 10:21894281-21894303 AAGAGGAAGGCTGGGCACGACGG + Intronic
1065651355 10:27895486-27895508 AAGACCCAGCCTGGCCAACATGG - Intronic
1066118411 10:32260477-32260499 AAGACTCAGCCTGGCCAACACGG - Intergenic
1066121764 10:32296131-32296153 ACCAGCCAGCCTGGCCAAGATGG - Intronic
1066345558 10:34581781-34581803 GAGAGGCAGTCTGGGAAAGAAGG + Intronic
1066515208 10:36151257-36151279 AAGACTCAGCCTGGCCAACATGG + Intergenic
1067828703 10:49597682-49597704 AAGAGGGAGTCTGGTCATGCGGG - Intergenic
1069377898 10:67812640-67812662 AAGACCCAGCCTGGCCAAGATGG + Intronic
1069443676 10:68453100-68453122 TAGAGACAGCCTGGCCAACATGG - Intronic
1069602325 10:69716073-69716095 AAGAGGCAGCCTGGGGGAGAAGG - Intergenic
1070055771 10:72933278-72933300 TCGAGCCAGTCTGGCCAACATGG - Intergenic
1070365459 10:75732669-75732691 AATAGGCAGTCTGGACATGCAGG - Intronic
1070612680 10:77944421-77944443 CAGAGGCAGTCTGGCCAACATGG - Intergenic
1072009574 10:91291427-91291449 AAGAGGAATCCTGCCCAAGATGG - Intergenic
1072027766 10:91479011-91479033 AAGTGTCAGTCTGGCCAACATGG + Intronic
1072404429 10:95136607-95136629 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1072467213 10:95676402-95676424 AAGACCAAGTCTGGCCAACATGG - Intronic
1075028188 10:119002440-119002462 AAGTGGCAGACAGGCCAGGAGGG - Intergenic
1075313138 10:121431277-121431299 AAAAAGAAGTCTGGCCATGAGGG - Intergenic
1076472683 10:130729749-130729771 AAGAGGCAGTCTGGGCGTGGTGG - Intergenic
1077093637 11:790311-790333 AAGGGGCACCCTGGCCTAGAGGG - Intergenic
1077195607 11:1278573-1278595 AAGAGTCGGCCTGGCCTAGAAGG - Intronic
1077240138 11:1506520-1506542 AAGACGCAGTCTGGACTAGGAGG + Intergenic
1078018097 11:7632659-7632681 GAGAGGCAAGCTGGCCCAGATGG + Intronic
1078106636 11:8361922-8361944 AAGAAGCAGAGTGGCCAAGCAGG - Intergenic
1078569852 11:12448289-12448311 AAGATGCAGCCTGGCCAGCATGG + Intronic
1078915600 11:15775489-15775511 AGGAGGCAGCCTGGCAAAGCAGG + Intergenic
1079139190 11:17796415-17796437 AAGAGGCAATCAGGTCATGAGGG + Intronic
1079510551 11:21205328-21205350 AAGAGGCAGTCTGGCTACAGTGG + Intronic
1079867926 11:25758717-25758739 GAGAGGCAGTCTGGCTACAATGG - Intergenic
1079971508 11:27041155-27041177 AAGAGGCTTTATGGCCTAGAGGG - Intronic
1080461802 11:32461219-32461241 GAGATGCAGCCTGGCCAATATGG - Intergenic
1080698974 11:34628046-34628068 AACAGCCAGTCTGGCCAACATGG + Intronic
1080803776 11:35633317-35633339 TAGAGACAGCCTGGCCAATATGG + Intergenic
1081726635 11:45334404-45334426 AAGAACCAGACTGGCCAACATGG - Intergenic
1082015897 11:47486608-47486630 TCGAGCCAGTCTGGCCAACATGG - Intronic
1082113363 11:48301050-48301072 GAAAGGCAGTCTGGACAACAAGG - Intergenic
1083674981 11:64320075-64320097 CAAAACCAGTCTGGCCAAGATGG + Intronic
1083919996 11:65777444-65777466 AAGAGGTGGTCAGGCCACGAGGG + Exonic
1085023163 11:73221667-73221689 AAGAGGAGGTGTGGCCCAGAGGG - Intronic
1085039851 11:73320432-73320454 AAGACTCAGCCTGGCCAATATGG + Intronic
1085249402 11:75132348-75132370 AAGAGGGACTCTGGCAGAGAGGG + Intronic
1085938168 11:81175545-81175567 AAGAGGCAGTCAGACGAACAGGG + Intergenic
1086312281 11:85548705-85548727 GAGAGGCAGTCTGGCCACAGTGG + Intronic
1086319740 11:85632440-85632462 AATGGCCAGTCTGGCCAACATGG - Intronic
1086432187 11:86746628-86746650 AAGAGCCAGTTTTGCCAAAAGGG + Intergenic
1086839337 11:91666442-91666464 ACGGGGGAGACTGGCCAAGATGG + Intergenic
1088059457 11:105629036-105629058 AAGGGCCAGTCTGGGCAAGATGG + Intronic
1088095924 11:106101543-106101565 AAAAGACAGCCTGGCCAACAAGG - Intergenic
1088525902 11:110754415-110754437 AAAAGTGAGTCTGGGCAAGATGG + Intergenic
1088861167 11:113801041-113801063 AAGACCAAGTCTGGCCAACAAGG - Intronic
1090088640 11:123673810-123673832 TCGAGACAGTCTGGCCAACATGG + Intergenic
1090168424 11:124576581-124576603 TCGAGACAGCCTGGCCAAGATGG - Intergenic
1091130914 11:133146658-133146680 AAGACCCAGCCTGGCCAACATGG - Intronic
1092162330 12:6322678-6322700 AAGACCCAGCCTGGCCAACATGG + Intronic
1093966526 12:25332772-25332794 AAGATGCAGTCTTGAAAAGAGGG - Intergenic
1094054748 12:26257235-26257257 AAGAGGCAGTCTGGCCTTTTGGG - Intronic
1095430244 12:42126272-42126294 GAGAGCCAGCCTGGCCAACATGG - Intronic
1096632101 12:52934357-52934379 CAGAACCAGTCTGGCCAACATGG + Intronic
1096941869 12:55355652-55355674 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1097049506 12:56213398-56213420 AAGAGCCATCCTGGCCAACATGG - Intronic
1098844961 12:75523564-75523586 AATAGGGAGTATAGCCAAGATGG - Intergenic
1099237375 12:80097663-80097685 TTGAGACAGTCTGGCCAACATGG + Intergenic
1099554799 12:84097849-84097871 GAGAGGCAGTCTGGCCATGGGGG - Intergenic
1100028236 12:90154243-90154265 AAGAGGCAGTCTGGCCTTTTGGG - Intergenic
1101581214 12:106042573-106042595 ATAAGGCAGTGTGGCCTAGATGG - Intergenic
1101584347 12:106071474-106071496 GAGAGGCTGTCTGCCTAAGACGG - Intronic
1101621784 12:106395767-106395789 AAGACCCAGCCTGGCCAACATGG + Intronic
1101737662 12:107475115-107475137 CAGAGGCAGCCAGGCCAGGATGG - Intronic
1103089260 12:118085955-118085977 AAGACCCAGCCTGGCCAACATGG + Intronic
1103574478 12:121867149-121867171 AAAAACCAGTCTGGCCAACATGG + Intergenic
1103734445 12:123050358-123050380 CAGAAGCAGTCAGGGCAAGATGG + Intronic
1103885933 12:124200190-124200212 AAGACCCAGCCTGGCCAACAGGG - Intronic
1103915696 12:124374524-124374546 AGGAGGCAACGTGGCCAAGAGGG + Intronic
1105511956 13:21059764-21059786 GAGAGCCAGCCTGGCCAACACGG + Intronic
1105555454 13:21443953-21443975 AGGAGTCAGCCTGGCCAACATGG + Intronic
1105643869 13:22295593-22295615 CAAATGCAGTGTGGCCAAGAGGG - Intergenic
1105871294 13:24507778-24507800 AAAAGCCAGTGTGGCCAGGAGGG - Intronic
1106280114 13:28259553-28259575 ATGAGCCAGCCTGGCCAACATGG - Intronic
1106377416 13:29203227-29203249 GAGAGGCAGTCTGGCTATGGCGG + Intronic
1108858256 13:54822229-54822251 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
1110019972 13:70457729-70457751 AAGAGGCAGTCTGGCAACAGGGG - Intergenic
1110590527 13:77251822-77251844 AAGAGGCAGTAGGCACAAGATGG + Intronic
1110743805 13:79029183-79029205 TAGTTGCAGTGTGGCCAAGAGGG - Intergenic
1110812876 13:79829889-79829911 AAGTGGGAGTCTGGGAAAGATGG - Intergenic
1110845657 13:80188098-80188120 AAGAGACAAACTGGCCATGAAGG - Intergenic
1110905011 13:80876006-80876028 CAAGGCCAGTCTGGCCAAGATGG + Intergenic
1112302949 13:98247024-98247046 AAGACCCAGCCTGGCCAACATGG + Intronic
1112479753 13:99764264-99764286 AAGAGCCAGCCTGGGCAACATGG - Intronic
1112709474 13:102111033-102111055 AAGAGGCAGTCTTGGGCAGAGGG - Intronic
1114441383 14:22751095-22751117 GAAAGGCTGTCTGGCCAAGGAGG + Intergenic
1114710087 14:24768873-24768895 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
1115201776 14:30861623-30861645 AAGTGTAAGTCTGCCCAAGAGGG + Intergenic
1115691006 14:35843902-35843924 GAGAGGCAGTCTGGCTACAATGG + Intronic
1115842719 14:37490167-37490189 GAGAGGCAGTCTGGCCACAGTGG + Intronic
1115965546 14:38883697-38883719 AAGACCCAGCCTGGCCAAAATGG - Intergenic
1117190205 14:53282144-53282166 AAGATCCAGCCTGGCCAACATGG - Intergenic
1117299229 14:54407560-54407582 GAGAGGCAGTCTGGCTACCATGG + Intronic
1118126286 14:62908402-62908424 AAGAGCCTCCCTGGCCAAGATGG + Intronic
1118522033 14:66596371-66596393 AGGAGGCAGACAGGCCTAGATGG - Intronic
1119292024 14:73502820-73502842 AGGAGGCAGGCTGGGCAAGGTGG - Intronic
1119493720 14:75060864-75060886 AAGACCCAGCCTGGCCAACATGG + Intronic
1119922118 14:78456052-78456074 AAGAGGCAGGATGGACAACAGGG - Intronic
1120201356 14:81541102-81541124 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1120802821 14:88711742-88711764 AAGACACAGCCTGGCCAACATGG + Intronic
1121058923 14:90885349-90885371 GAGAGGCATCCTGGCCAACATGG + Intronic
1121911436 14:97795748-97795770 AGGAGGAACACTGGCCAAGAGGG + Intergenic
1122127625 14:99587695-99587717 AGGAGGCAGGCCGGCCAAGCAGG + Intronic
1123430026 15:20206775-20206797 ACGAGCCAGCCTGGCCAACATGG + Intergenic
1124428271 15:29582141-29582163 ATTAGCCAGCCTGGCCAAGATGG - Intergenic
1124666730 15:31598931-31598953 CAGAGGCAGTCTGGCCACGGCGG - Intronic
1124690972 15:31822549-31822571 AAGAGGCAGGGTGGCCAGGCTGG - Intronic
1125288537 15:38120147-38120169 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
1126127407 15:45308353-45308375 AAGACCCAGCCTGGCCAACATGG + Intergenic
1126626424 15:50689784-50689806 ATGATGCAGTCTGGGCAACATGG + Intergenic
1127030041 15:54851461-54851483 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
1127265743 15:57360201-57360223 AAAATGCAGCCTGGCCAACATGG + Intergenic
1127413642 15:58734497-58734519 AAAAGACAGCCTGGGCAAGATGG + Intronic
1127725091 15:61742235-61742257 GAGAGGCAATGTGGCCATGAGGG + Intergenic
1127835225 15:62785460-62785482 AAGACCCAGCCTGGCCAACATGG + Intronic
1128051241 15:64666710-64666732 ACCAGCCAGCCTGGCCAAGATGG - Intronic
1128171537 15:65517720-65517742 AAGGCGCAGCCGGGCCAAGAAGG + Intergenic
1128939535 15:71777170-71777192 AAGAGGCAGCCTGGACCAGTGGG - Intronic
1129367265 15:75063981-75064003 GAGTGGGACTCTGGCCAAGAGGG + Intronic
1129529140 15:76248672-76248694 AAGAATCAGCCTGGCCAACATGG + Intronic
1129878767 15:78993806-78993828 AAGAGGCATTCTGGCCAAGGTGG + Intronic
1131057634 15:89385046-89385068 CAGAGGCAGTGTGGCCCAGTGGG + Intergenic
1131274635 15:90970605-90970627 AGGAGGCAGTCTAGGGAAGACGG + Intronic
1131470574 15:92693268-92693290 CAAAGCCAGCCTGGCCAAGATGG - Intronic
1131517917 15:93091551-93091573 AAAAGGAAGAGTGGCCAAGAAGG - Intergenic
1131942644 15:97584521-97584543 AAGAGGCACTCTGGCCAGTTGGG + Intergenic
1132415393 15:101615374-101615396 AAGAGGGAGGCTGGCCTGGAGGG + Intergenic
1132474657 16:128190-128212 AGGAGACAGCCTGGCCAACATGG - Intronic
1132682549 16:1149122-1149144 AAGAAGCATTCTGGCCAGGCAGG + Intergenic
1132836374 16:1955273-1955295 AAAAGCCAGCCTGGCCAACATGG + Intronic
1132865134 16:2089545-2089567 AAGAGGCTGTGTGGCCAACCAGG - Exonic
1132982721 16:2746931-2746953 AAAATGCAGCCTGGCCAACATGG - Intergenic
1133106545 16:3513932-3513954 AAGTGGAAGTCTGGGGAAGAGGG + Intronic
1133242718 16:4425122-4425144 AAGACCCAGCCTGGCCAAGATGG + Intronic
1133332010 16:4980739-4980761 AAGAGGCAGTCGTGCCTAGGAGG + Intronic
1133956962 16:10452799-10452821 GAGAGGCAGTCTGGCCACAGTGG + Intronic
1134875560 16:17695374-17695396 ACAAGGATGTCTGGCCAAGAAGG - Intergenic
1135699350 16:24618118-24618140 AAGACCCAGTCTGGGCAACATGG - Intergenic
1135970831 16:27070808-27070830 AAGAGGCAGTCAGGGGAAGGTGG - Intergenic
1136463646 16:30427511-30427533 ATGACCCAGTCTGGCCAACATGG - Intronic
1136854609 16:33644444-33644466 ACGAGCCAGCCTGGCCAACATGG - Intergenic
1137276568 16:46938282-46938304 AAAAGGCAGACCGGGCAAGATGG - Intergenic
1138735564 16:59246992-59247014 CAGGGCCAGCCTGGCCAAGATGG + Intergenic
1138918065 16:61492137-61492159 CAAGGGCAGTCTGGCCAATATGG + Intergenic
1139174514 16:64671132-64671154 AAAGGCCAGCCTGGCCAAGATGG - Intergenic
1139922098 16:70467019-70467041 CAGAGGCAGGGTGGGCAAGAAGG - Intronic
1140185067 16:72761922-72761944 AAGAGGCACTCAGGGCAAAAAGG - Intergenic
1141360631 16:83392172-83392194 ATGAGGCAGTGGGGCCAGGATGG - Intronic
1141470357 16:84234144-84234166 AAGAGGCAGTGTAGACAGGAAGG - Intronic
1141577118 16:84971255-84971277 GGGAGGCAGTGTGGCCAAGGTGG - Intergenic
1142107229 16:88310778-88310800 AAGCAGCAGCCTGGCCAAAATGG - Intergenic
1142344651 16:89546284-89546306 AGTGGGCAGTCTGGCCAACACGG - Intronic
1142755755 17:2015506-2015528 AGGAGGGAAGCTGGCCAAGACGG + Intronic
1143280027 17:5746941-5746963 AAGACCCAGCCTGGCCAACATGG - Intergenic
1146286255 17:31575964-31575986 AGAAGGCAGCCTGGCCAACATGG + Intergenic
1146511539 17:33453450-33453472 AAGAGGCAGGGAGGCCATGAAGG + Intronic
1146978022 17:37132466-37132488 GAGAGGCAGTCTGTCCCAGAAGG - Intronic
1147123044 17:38347260-38347282 AAAAATCAGCCTGGCCAAGATGG + Intergenic
1147472452 17:40675677-40675699 AATATCCAGTCTGGCCAACATGG - Intergenic
1147559176 17:41498468-41498490 ATGAGGAAGTCAGGCCAGGAAGG + Intergenic
1148504226 17:48114656-48114678 AAAACCCAGCCTGGCCAAGATGG - Intronic
1149222906 17:54436273-54436295 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1149324729 17:55518319-55518341 AAGAGGCAATTTGGCCATGAGGG - Intergenic
1149359993 17:55885037-55885059 GAGAGGCAGTCTGGCCACAGCGG - Intergenic
1149365480 17:55939401-55939423 GAGAGGCAGTCTGGCCATAGCGG - Intergenic
1149900312 17:60470775-60470797 AAAATCCAGTCTGGCCAACATGG - Intronic
1150034488 17:61779417-61779439 AAGATAAAGTCTGGCCAAAATGG + Intronic
1150066886 17:62117692-62117714 AAGACCCAGCCTGGCCAACATGG + Intergenic
1150545639 17:66154889-66154911 AAGAGGTAGTTAGGCCATGAAGG + Intronic
1150613024 17:66748962-66748984 AAGATGCAGACTGGCCAGGGAGG - Intronic
1150613043 17:66749042-66749064 AAGATGCAGACTGGCCAGGGAGG - Intronic
1150613061 17:66749122-66749144 AAGATGCAGACTGGCCAGGGAGG - Intronic
1153495773 18:5697120-5697142 AACAGACAGACTGGCCAAAATGG - Intergenic
1153785121 18:8527907-8527929 ATGAGGCAGGGTGGCCAAGATGG + Intergenic
1155241568 18:23868413-23868435 ATGAGTCAGCCTGGGCAAGATGG + Intronic
1156276122 18:35584451-35584473 AAGAGGCAGTTAGGCAAAGAGGG + Intronic
1156529260 18:37799064-37799086 AAGAGGTAGTTAGGCCATGAGGG + Intergenic
1157499304 18:48178882-48178904 AAGAGGCAGCCTTGCCCAGAGGG - Intronic
1158185925 18:54771160-54771182 GACAGTCAGTTTGGCCAAGAAGG + Intronic
1158729045 18:60003070-60003092 AAGAGGCAGTCTGGCCTTTTGGG + Intergenic
1158967710 18:62637088-62637110 GAGACCCAGCCTGGCCAAGATGG - Intergenic
1159619493 18:70620948-70620970 AAGAGGAAGTCTGGCTAGCAAGG - Intergenic
1159637137 18:70819009-70819031 ACCAGCCAGCCTGGCCAAGATGG + Intergenic
1159703934 18:71663526-71663548 AAGATGCAGTGTGGCCATGGAGG + Intergenic
1160437176 18:78860521-78860543 AAGAGGCAGCCTGGCTTTGAGGG - Intergenic
1161243860 19:3238152-3238174 AAGACCCAGCCTGGCCAACATGG + Intronic
1161376064 19:3939561-3939583 AAGACTCAGTCTCCCCAAGAAGG - Intronic
1161604724 19:5208258-5208280 AAGGAGCAGTTTGGCCAGGACGG - Exonic
1162211680 19:9096831-9096853 CAAAAGCAGTCTGGCCAACATGG + Intergenic
1162706960 19:12562165-12562187 TCGAGACAGTCTGGCCAAAATGG + Intronic
1162916845 19:13879138-13879160 AAGACTCAGCCTGGCCAAGATGG - Intronic
1163851462 19:19666503-19666525 AAGACTCAGCCTGGCCAAGAAGG - Intergenic
1163922317 19:20302471-20302493 CAAAAGCAGCCTGGCCAAGATGG - Intergenic
1163971823 19:20805392-20805414 CAAAGGCAGCCTGGCCAAGATGG - Intronic
1164469347 19:28516336-28516358 AGGAGCCAGCCTGGCCAACATGG - Intergenic
1164852006 19:31491824-31491846 CAGAGGCAGCCATGCCAAGACGG - Intergenic
1165212001 19:34243382-34243404 TCGAGACAGTCTGGCCAACATGG + Intergenic
1165695840 19:37900358-37900380 AAGAACCAGCCTGGCCAACATGG + Intronic
1165875285 19:39002293-39002315 AAAAGGCATCATGGCCAAGAGGG + Intronic
1166666912 19:44685656-44685678 AAGAATCAGCCTGGCCAAGATGG + Intergenic
1166900513 19:46058227-46058249 ATGTGACAGACTGGCCAAGATGG + Intronic
1167451684 19:49574060-49574082 AAGACCCAGCCTGGCCAACATGG - Intronic
1167540598 19:50084854-50084876 AGAAGGCAGCCTGGCCAACACGG + Intergenic
1167629118 19:50612961-50612983 AGAAGGCAGCCTGGCCAACACGG - Intergenic
1167912948 19:52718968-52718990 CAAGAGCAGTCTGGCCAAGATGG + Intronic
1168289777 19:55351972-55351994 AGGAGGAAGGCTGGCCAACAGGG + Intronic
1202714007 1_KI270714v1_random:32475-32497 ATGGGGCAGCCTGGCCATGAAGG - Intergenic
924967641 2:92713-92735 GAGAGGCAGTCTGGCTATGGAGG - Intergenic
927134073 2:20083960-20083982 AAGAAGCAGTCTGGGGATGAGGG - Intergenic
929474120 2:42228017-42228039 CAGAAGCAGCCTGGCCAACATGG + Intronic
930264708 2:49186198-49186220 GAGAGGCAGTCTGGCCACAGGGG + Intergenic
931928327 2:67099525-67099547 CAGATGCAGTCAGACCAAGACGG - Intergenic
932458187 2:71863291-71863313 GAGAGGCTCTCTGGCGAAGATGG + Intergenic
932588700 2:73049599-73049621 AAGAGGCAATTAGGCCATGAGGG - Intronic
933511849 2:83249723-83249745 CAAAGGCAGACTGGGCAAGAAGG + Intergenic
934244177 2:90293649-90293671 AAAAGACAGCCTGGCCAACATGG + Intergenic
934496868 2:94810346-94810368 CAAAAGCAGTCTGGCCAACATGG - Intergenic
935356675 2:102207824-102207846 GAGAGGCAGTCTGGGCCACAGGG - Intronic
936513985 2:113170205-113170227 AAGACCCAGCCTGGCCAACATGG + Intronic
936697494 2:114967456-114967478 AAGAGGAAGACTGGCATAGAGGG + Intronic
936989956 2:118352656-118352678 AAGAGGCCTTCTGGCTAAGTGGG + Intergenic
938098437 2:128478687-128478709 TTGAGGCAGTCTGGCCAACATGG - Intergenic
938160929 2:128983774-128983796 AAGAGGCAGCCTTGCCATGAGGG + Intergenic
938314478 2:130316460-130316482 AAAAGGCAGTCTGAGCAAAATGG + Intergenic
938629316 2:133148795-133148817 AAGAGGCAGTTAGGTCATGAGGG - Intronic
940602624 2:155880633-155880655 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
940667059 2:156621646-156621668 AAGAGGCAATTAGGCCATGAGGG + Intergenic
940946524 2:159624119-159624141 GAGAGGCAGTCTGGCCACAGAGG - Intergenic
941236330 2:162979423-162979445 AAGAGCCAGTCAGGCAAATAAGG + Intergenic
941601369 2:167547238-167547260 AACGGGCAGGCTGACCAAGAGGG - Intergenic
942010843 2:171761250-171761272 GAGAGGCAGTCTGGCCACAGCGG + Intergenic
943953990 2:194162658-194162680 GAGTGGGACTCTGGCCAAGAAGG - Intergenic
945486874 2:210406910-210406932 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
945838402 2:214859403-214859425 GAGAGGCAGTCTAGCAAAGGAGG - Intergenic
946714088 2:222535175-222535197 AAGACTCAGCCTGGCCAACATGG + Intronic
947613699 2:231540496-231540518 AAAAGGCAGCCTGGCCAACATGG - Intergenic
947746950 2:232512704-232512726 TAGAGGCAGCCTGGCCAGGCAGG - Intergenic
947907498 2:233775943-233775965 AAGAGGAAGTATGAGCAAGAGGG - Intronic
948037890 2:234873887-234873909 AAGAGGCAGGCTGGCGGGGAAGG + Intergenic
948284577 2:236773789-236773811 AGGAGGCAGCCTGACCAACATGG - Intergenic
948378741 2:237539013-237539035 AGGAGACAGCCCGGCCAAGATGG + Intronic
1168888033 20:1273963-1273985 TAGAGGCAGTATGGCTTAGAGGG - Intronic
1169255567 20:4094403-4094425 TAGAGACAGACTGGCCAACATGG + Intergenic
1170335757 20:15268448-15268470 AAGACCCAGCCTGGCCAAGATGG + Intronic
1171010095 20:21504845-21504867 GAGAAGCAGCCTGGCCTAGAAGG + Intergenic
1171469943 20:25362364-25362386 CAAAACCAGTCTGGCCAAGATGG + Intronic
1172085402 20:32378217-32378239 AAGAGCCAGGCTGGGCAACATGG - Intronic
1172254418 20:33504602-33504624 TCGAGACAGTCTGGCCAACATGG - Intronic
1173033117 20:39380556-39380578 AAGAGAGAGTGTGCCCAAGATGG - Intergenic
1173191179 20:40876684-40876706 AGCAGGCAGCCTGGCCAAAAGGG + Intergenic
1173479583 20:43388663-43388685 GAGAGGCATTCTGCCCAAGGAGG + Intergenic
1173612124 20:44376998-44377020 AAGAGCCAGCCTGGGCAACATGG + Intronic
1174389553 20:50209685-50209707 AAGACGCAGCCTGGCCAACATGG - Intergenic
1175352335 20:58333077-58333099 AAGACCCAGCCTGGCCAATATGG + Intronic
1175529932 20:59667661-59667683 CAGAGGCAGGCTGGCCTGGAAGG - Intronic
1176554162 21:8246209-8246231 AAGAGGCGGTCAGACCAACAGGG + Intergenic
1176573084 21:8429233-8429255 AAGAGGCGGTCAGACCAACAGGG + Intergenic
1177544158 21:22534985-22535007 AAGAGCCAAGATGGCCAAGATGG + Intergenic
1177608881 21:23420186-23420208 GAGACCCAGTCTGGCCAACATGG - Intergenic
1178864426 21:36316389-36316411 GAGAGGCAGTCTGGCTATGGAGG + Intergenic
1178927815 21:36790728-36790750 AGGAGGCTGTCTGCCCAGGAAGG + Intronic
1180017348 21:45096055-45096077 AAGTGGCTGACTGGCCAAGCGGG + Intronic
1182204510 22:28610012-28610034 GAGAGGCAGTCTGGCCACAGTGG - Intronic
1183172428 22:36198082-36198104 AAGAGCCAGTCGGGCCCAGTGGG - Intronic
1183341552 22:37284504-37284526 AAGACCCAGTCTGGGCAACAGGG - Intronic
1183848886 22:40566420-40566442 CAGTACCAGTCTGGCCAAGATGG - Intronic
1183946131 22:41326827-41326849 AAGAGGCAGTGAGACCATGAAGG - Intronic
1184361377 22:44020979-44021001 AGGAGTCAGCCTGGCCAACATGG - Intronic
1184837315 22:47031666-47031688 AGGAGGCAGGCGAGCCAAGATGG - Intronic
1203259168 22_KI270733v1_random:163249-163271 AAGAGGCGGTCAGACCAACAGGG + Intergenic
949155036 3:816925-816947 GAGAGGCAGTCTGGCCACCATGG - Intergenic
949800990 3:7904294-7904316 AAGACACAGACTGGCAAAGAAGG - Intergenic
949804214 3:7936400-7936422 AAGACACAGACTGGCAAAGATGG + Intergenic
950017281 3:9763065-9763087 ATAGGGCAGTCTGGCAAAGAGGG + Intronic
950943029 3:16913183-16913205 GAGGCCCAGTCTGGCCAAGACGG - Intronic
951495247 3:23318016-23318038 AAGAGGGAGTCAGAACAAGATGG - Intronic
952790398 3:37195983-37196005 AAAAGACAGCCTGGCCAACATGG + Intergenic
953173419 3:40527530-40527552 AAAATGCAGCCTGGCCAACATGG - Intronic
953811722 3:46118154-46118176 GAGTGGGACTCTGGCCAAGAGGG - Intergenic
954287647 3:49630160-49630182 AGGTGGCAGTGTGGCCAGGAGGG - Intronic
954307338 3:49735629-49735651 AAGATGCAGACTGGCCAAAGAGG + Intronic
955329557 3:58035756-58035778 AAGAGGCATTCTGTCCAACTAGG - Intronic
955909523 3:63845796-63845818 AAAAGGCAGACTGGCCAGAAGGG - Intronic
956220114 3:66893451-66893473 GAGAGGCAGTCTGGCTACAACGG - Intergenic
956411249 3:68982194-68982216 AATTGGCAGACTGGCCACGATGG - Intronic
957011210 3:75008284-75008306 GAGAGGCAGTCTGGCTACAAGGG + Intergenic
959091790 3:101911170-101911192 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
959266228 3:104142349-104142371 CAGAGGCAGTGTGTCCAACATGG - Intergenic
962044265 3:131739053-131739075 AAAAAGCAGCCTGGCCAACATGG - Intronic
962164196 3:133032026-133032048 AAGAGACAGCCTGGCCATGCAGG + Intergenic
962745862 3:138396791-138396813 AAGAGGCCATCTGGGCAGGAAGG - Intronic
963009616 3:140756723-140756745 AAGAGGCAGTGTGGGGAAGAGGG + Intergenic
964112120 3:153098499-153098521 AAGAAACAGCCTGGCCAACATGG - Intergenic
966357354 3:179095068-179095090 AAGATCCAGCCTGGCCAACATGG - Intergenic
966493747 3:180556716-180556738 GAGAGGCAGTCTGGCCACAGCGG - Intergenic
966625664 3:182013720-182013742 TTGAGACAGTCTGGCCAACATGG - Intergenic
966727594 3:183121121-183121143 AAGAGGCAGTGGGGTCATGATGG + Intergenic
966810855 3:183843313-183843335 AATAAGCAGTCTGGGCAACATGG + Intronic
966928634 3:184661576-184661598 AAAAAGCAGCCTGGCCAACATGG - Intronic
968748132 4:2371767-2371789 AAGACACAGTCTGGCCACTAAGG + Intronic
968950546 4:3689184-3689206 AAGAGGCGGTGTGGTCACGAGGG + Intergenic
969126603 4:4953379-4953401 AACAGGCAGTTTACCCAAGATGG - Intergenic
969388473 4:6872874-6872896 AAGAGTCAACCTGGCCAAGCTGG - Intronic
969826013 4:9758910-9758932 AAGAGGCAGGGGGGGCAAGAGGG - Intergenic
970936187 4:21572825-21572847 AAAGAGCAGTCTGGCCAACATGG - Intronic
971468208 4:26988381-26988403 AAGAGCGAGCCTGGCAAAGAAGG + Intronic
972279319 4:37587144-37587166 AAGAGGCAATGTGACCAAAAAGG - Intronic
972492129 4:39597642-39597664 CAGTGACAGTCTGGCCAACATGG - Intronic
972993147 4:44847154-44847176 CAGAGGCAATCAGGCCATGAGGG - Intergenic
974283402 4:59830304-59830326 AAGAGGCATTTTGGCCGTGAGGG - Intergenic
975132475 4:70842832-70842854 AAGAGGCAGCCTGGGCAACCTGG + Intergenic
976061238 4:81130706-81130728 GAGAGGCAGTCTGGCTACGGTGG + Intronic
977195334 4:94051915-94051937 AAGACCCAGTCTGTCCAACAAGG + Intergenic
977467733 4:97403073-97403095 GAGAGGCAGTCTGGCCACAGTGG + Intronic
977723463 4:100267489-100267511 GAGAGGCAGTCTGGCTAAAGTGG + Intergenic
977773949 4:100895072-100895094 AAGAAGCAGTCTGGCCCAATGGG + Intergenic
977774448 4:100900870-100900892 GAGAGGCAGTCTGGCTACGAAGG - Intergenic
978094886 4:104763757-104763779 AAAGGGCTGTCTGGCCAAGCCGG - Intergenic
978515298 4:109561947-109561969 ACCAGCCAGTCTGGCCAACATGG - Intronic
978539638 4:109803311-109803333 AAGAGGCAGGCTGGACATGGTGG + Intergenic
978598095 4:110400395-110400417 AGCAGGCAGTTTGGCAAAGAAGG - Intronic
979012342 4:115387672-115387694 GAGAGGCAGTCTGGCTACTAAGG - Intergenic
979417477 4:120461080-120461102 GAGAGGCAGTCTGGCTACGGTGG - Intergenic
979512251 4:121567728-121567750 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
980907517 4:138962725-138962747 AAGACCAAGCCTGGCCAAGATGG + Intergenic
981558688 4:146023596-146023618 AAAAGGCAGTCTGGGCCACAAGG - Intergenic
981939989 4:150271783-150271805 GAGAGGCAGTCTGGCCACAGTGG - Intronic
982024208 4:151235583-151235605 AAGACCCAGCCTGGCCAACATGG + Intronic
982323900 4:154109206-154109228 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
982510420 4:156275492-156275514 AAGAGCAAGCCTAGCCAAGATGG + Intergenic
982733255 4:158979085-158979107 GAGAGGCAGTCTGGCTAAAGTGG + Intronic
982733437 4:158980129-158980151 GAGAGGCAGTCTGGCCACAGTGG - Intronic
983574797 4:169249250-169249272 AAGAGGCAATTAGGCCATGAGGG + Intronic
984269804 4:177536827-177536849 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
984300631 4:177912533-177912555 AAAAGACAGCCTGGCCAACATGG - Intronic
984618668 4:181927447-181927469 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
985112263 4:186557658-186557680 AAGAGGCGATCAGGTCAAGAGGG + Intergenic
985845951 5:2347116-2347138 TAGAGGGAAGCTGGCCAAGATGG - Intergenic
986124226 5:4870225-4870247 AAGATGCAGCCTGGCCCACAGGG - Intergenic
986149570 5:5115137-5115159 AGGAGGCAGTCTGTCCATTATGG + Intergenic
986286062 5:6360044-6360066 AAGAGGAAGGCTGGGCAGGAAGG + Intergenic
987064331 5:14273555-14273577 AAGAGGCAATTAGGCCATGAGGG + Intronic
987564209 5:19564135-19564157 GAAAGGCAGTCTGGGCCAGAAGG + Intronic
987887512 5:23831013-23831035 AAAAAGTAGTCTGGCCAAGTAGG - Intergenic
988239390 5:28589975-28589997 AAGAGGCACTTAGGCCATGAAGG - Intergenic
988402129 5:30775860-30775882 GAGAGGCAATCTGGCCACAAGGG - Intergenic
988476937 5:31594694-31594716 AAGACTCAGCCTGGCCAAGATGG - Intergenic
988907946 5:35809411-35809433 TGGAGGGAGTCTGCCCAAGAAGG + Intronic
989092168 5:37744347-37744369 AAGAGGCACTCTGGCCTTGTGGG - Intronic
991151495 5:63376235-63376257 GAGAGGCAGTCTGGCCACAGAGG - Intergenic
991665497 5:68995606-68995628 AAGGGCCAGCCTGGCCAACATGG - Intergenic
992506053 5:77388787-77388809 GAGAGGCAGTCTGGCCACAGCGG + Intronic
992852538 5:80824900-80824922 AAAGGGCAGTCTGTCCCAGACGG - Intronic
993172351 5:84435187-84435209 GAGAGGTAGTTAGGCCAAGAAGG + Intergenic
993511963 5:88781770-88781792 AAGACCCAGCCTGGCCAACATGG + Intronic
993960938 5:94296122-94296144 AAGAGGCAGTCTGGCTACAATGG + Intronic
994087846 5:95779819-95779841 AAGGGGAAGCATGGCCAAGATGG + Intronic
994143799 5:96370498-96370520 AAGAACCAGTCTGGCCCTGAAGG - Intergenic
994473591 5:100239625-100239647 AAGAACCAGCCTGGCCAATATGG - Intergenic
995108227 5:108399202-108399224 GAGAGGCAGTCTGGCCATGTAGG - Intergenic
995258254 5:110072440-110072462 TCTAGGCAGTCTGGACAAGAGGG - Intergenic
995480395 5:112586761-112586783 AAGAGGCAGTCTGGCCGCAGTGG - Intergenic
995584828 5:113637415-113637437 CAAGGCCAGTCTGGCCAAGATGG + Intergenic
995666290 5:114545549-114545571 AAGAGGCAGTCTGGCCTTTTGGG - Intergenic
996706374 5:126502405-126502427 AAGACGCTGTCAGGCCATGAGGG - Intergenic
996953284 5:129153191-129153213 GAGAGGCAGTCTGGCTAAAGCGG + Intergenic
997216671 5:132117185-132117207 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
997230160 5:132236567-132236589 GAGAGGCAGCCTGGGCAACATGG - Intronic
997744207 5:136284695-136284717 AAGAGGCACCCAGCCCAAGAAGG + Intronic
998190776 5:140022568-140022590 AAGAGGAAGTCTAGCATAGATGG + Intronic
998220347 5:140273042-140273064 AAGACCAAGTCTGGCCAATATGG + Intronic
999150114 5:149421252-149421274 AAAAGCCAGGCAGGCCAAGAAGG + Intergenic
999185302 5:149703077-149703099 GAGAGGCAGCCTGGCCAACTGGG - Intergenic
999642155 5:153682608-153682630 AAGAGGAATTCTGGCTAAAATGG - Intronic
999797291 5:155000696-155000718 AAGACCCAGCCTGGCCAACATGG - Intergenic
1000350523 5:160349217-160349239 AAGAGGCTGTCTGTCCAGTAAGG + Exonic
1001840155 5:174869038-174869060 AAAACCCAGTCTGGCCAACATGG + Intergenic
1002503033 5:179659417-179659439 AAGAGCCATCCTGGCCAACATGG - Intergenic
1003068095 6:2920356-2920378 AAGACCCAGCCTGGCCAACATGG - Intergenic
1003266706 6:4572135-4572157 AAGAGTCATTGAGGCCAAGATGG + Intergenic
1003389768 6:5703678-5703700 AAGAGACTCTCAGGCCAAGATGG - Intronic
1003479091 6:6514873-6514895 AAGAGGAAGAATGGCCAAGAAGG + Intergenic
1004701646 6:18085225-18085247 AAGAGAGAGTGTGGCAAAGAAGG - Intergenic
1004926456 6:20420064-20420086 AGGAGGCAGGCTGGGCAACATGG - Intronic
1005039024 6:21585264-21585286 AAGAGCCAGCCTGGCCAACATGG + Intergenic
1005061662 6:21782399-21782421 AAGAGCCAGCCTGGCCAACACGG - Intergenic
1005391224 6:25335639-25335661 CAGAGGCTGTCTGTACAAGAAGG + Intronic
1006380687 6:33695410-33695432 AAGAGGATGTCTAGGCAAGAGGG - Intronic
1006414815 6:33897233-33897255 AGGAGGCACTTTGGCCAGGATGG + Intergenic
1006911891 6:37568756-37568778 AAGAGGGAGCCAGGCCCAGAGGG + Intergenic
1007240751 6:40423319-40423341 AAGAGGCAGGCTGGGGAATAGGG + Intronic
1008244134 6:49150057-49150079 AAGAGGCACTCTGGCCATTTGGG + Intergenic
1009408462 6:63337260-63337282 AAAAGCCAGCCTGGCCAACATGG + Intergenic
1009859156 6:69303530-69303552 AAGAGGAAGGGTGACCAAGATGG - Intronic
1009880531 6:69560894-69560916 GAGAGGCAGTCTGGCTACAACGG - Intergenic
1010012859 6:71069304-71069326 AAGAGGCAATTAGGCCATGAGGG - Intergenic
1011120110 6:83942888-83942910 GAGAGGCAGTCTGGCTATCATGG - Intronic
1011137387 6:84115290-84115312 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
1011249531 6:85356359-85356381 AAGAGGCAATTAGGCCATGAAGG - Intergenic
1012423304 6:99088350-99088372 AAGAGCCAGCCTGGCCAACATGG + Intergenic
1013964236 6:115935775-115935797 GAGAGGCAGTCTGGCCAGAGTGG - Exonic
1014789071 6:125651095-125651117 AAGTGTCAGCCTGGCCAACATGG - Intergenic
1015290784 6:131536202-131536224 AAGACCCAGCCTGGCCAACATGG - Intergenic
1015291101 6:131538987-131539009 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1015324953 6:131914395-131914417 AAGAGGTAGTTAGGCCAGGAGGG - Intergenic
1015623374 6:135156051-135156073 TAGAGGCAGTCTGGCTACGGTGG + Intergenic
1015802098 6:137070558-137070580 AAGAGGCAGTCTGGCTACAAAGG - Intergenic
1016289098 6:142507636-142507658 TAGAGAGAGGCTGGCCAAGATGG - Intergenic
1017167829 6:151426322-151426344 CAGAGGCAGTATGAACAAGATGG - Intronic
1017172432 6:151470538-151470560 AAGAGGAAGTCAGGTCAAGGTGG + Intergenic
1017587740 6:155945774-155945796 AAGAGAAAGTCTGACCAAGCCGG - Intergenic
1017599447 6:156064703-156064725 AAAAGGCAGGCTGGCCAGCATGG + Intergenic
1017994714 6:159521834-159521856 AAATGCAAGTCTGGCCAAGATGG - Intergenic
1019867456 7:3725631-3725653 AACAGGGAGGCTGGCCAAGCTGG + Intronic
1020420168 7:7994598-7994620 AAGAGGCAATTAGGCCATGAGGG - Intronic
1020527165 7:9276453-9276475 AAGAACCACTCTGGCCAACATGG - Intergenic
1020600224 7:10265987-10266009 AAGGGGAATTCTTGCCAAGAAGG - Intergenic
1020694059 7:11392807-11392829 GAGAGGCAGTCTGGCTACAAGGG - Intronic
1020716076 7:11675689-11675711 GAGAGGCAGTCTGGCTACCATGG - Intronic
1021923007 7:25505903-25505925 AAAAGGCAGTCTGGGCCACAAGG + Intergenic
1021990120 7:26133025-26133047 AAAAGGCAGCCTGGCCAACATGG + Intergenic
1024587506 7:50854541-50854563 TAGAGGCAGTGTGGCCCAGGAGG + Intergenic
1026606646 7:71821952-71821974 GAGATGCAGTCTGGCCATGTTGG + Intronic
1027262863 7:76477389-76477411 GAGAGGCAGGGAGGCCAAGATGG + Intronic
1027314245 7:76975498-76975520 GAGAGGCAGGGAGGCCAAGATGG + Intergenic
1028144321 7:87304781-87304803 GAGAGGCAGTCTGGCCACCGTGG - Intergenic
1028145857 7:87319231-87319253 GAGAGGCAGTCTGGCCACAGCGG + Intergenic
1028315178 7:89392812-89392834 AAGAGGGTATCAGGCCAAGAAGG + Intergenic
1029324732 7:99796429-99796451 GAGAGGCAGTCTGGCCACAGTGG + Intergenic
1029561593 7:101306544-101306566 AAGAGGCAGGCTGGGCACGGTGG + Intergenic
1029650008 7:101885236-101885258 CAGAGGCTCTCTGGCCAGGAGGG + Intronic
1030318841 7:108143620-108143642 AAGACCCAGCCTGGCCAACATGG + Intergenic
1031440737 7:121791868-121791890 AAGCAGGAATCTGGCCAAGAGGG + Intergenic
1032285251 7:130534737-130534759 TAAAGGTAGTGTGGCCAAGAGGG + Intronic
1032286036 7:130539129-130539151 TAAAGGTAGTGTGGCCAAGAGGG + Intronic
1035099120 7:156382131-156382153 AAGACCCAGCCTGGCCAACATGG - Intergenic
1035710776 8:1712303-1712325 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1035776069 8:2189676-2189698 AACAGGCAGCCTGGACCAGAGGG - Intergenic
1036547825 8:9789304-9789326 CTGAGGCAGTCTGGGCAACATGG + Intergenic
1036729405 8:11249124-11249146 AAGAACCATCCTGGCCAAGATGG + Intergenic
1038149836 8:24932622-24932644 AAGAGACAGTGTGGGGAAGATGG + Intergenic
1039168398 8:34713447-34713469 AAGACCCAGCCTGGCCAACATGG + Intergenic
1039417456 8:37408005-37408027 AAAAGCCAGCCTGGCCAACATGG + Intergenic
1040498414 8:47986986-47987008 AAGAACCAGACTGGCCAACATGG - Intergenic
1040900880 8:52415742-52415764 CAGAGGCAGCCTGGCCACTAAGG - Intronic
1040911223 8:52521141-52521163 AAGAAGAAGTAAGGCCAAGAAGG + Intergenic
1041119341 8:54570527-54570549 TCGAGACAGCCTGGCCAAGATGG - Intergenic
1041369121 8:57141813-57141835 AAGACTCAGCCTGGCCAAGATGG + Intergenic
1041715404 8:60927452-60927474 AAGAGGCAGGCTGGGCTGGAAGG + Intergenic
1042203669 8:66306615-66306637 AAGAGGCAATTAGGCCATGATGG - Intergenic
1042553236 8:70012884-70012906 AAGAACCAGCCTGGCCAACATGG - Intergenic
1043344454 8:79283853-79283875 AAGAGGAAGGCTGGCAAAGCTGG + Intergenic
1044504981 8:93006735-93006757 AAGAGGCAGTCTGGCCAAGATGG - Intronic
1044658996 8:94577484-94577506 AAGACCCAGCCTGGCCAACATGG + Intergenic
1045974441 8:108115585-108115607 AATAGGCAGCTAGGCCAAGAGGG - Intergenic
1046283329 8:112062197-112062219 AAGAGGTAGTCAGGCCATGAGGG + Intergenic
1046798924 8:118403375-118403397 AAGAGGCAGTATGGCAGAGTGGG + Intronic
1047117561 8:121861531-121861553 AAGAGGGAGTGCTGCCAAGAAGG - Intergenic
1047236484 8:123046460-123046482 GAGAGGCAGTGTGGCCTAGTGGG - Intronic
1047367169 8:124222224-124222246 TCGAGACAGCCTGGCCAAGATGG + Intergenic
1048914092 8:139165389-139165411 GCGAGGCAGTCTGGCCATGATGG + Intergenic
1048949693 8:139485659-139485681 AAGAGGCAATGTGACCAACACGG - Intergenic
1049700891 8:144011962-144011984 AAGGGGCATCCTGGCCAGGAAGG + Intronic
1050553876 9:6772347-6772369 AAGGACCAGTCTGGCCAACATGG - Intronic
1050998199 9:12246067-12246089 CAAAAGCAGCCTGGCCAAGATGG + Intergenic
1051391641 9:16571554-16571576 AAGAGGCAGTGTGTCAAAGCTGG - Intronic
1051892381 9:21956397-21956419 TAGATGCAGCCTGGCCAATATGG + Intronic
1052336370 9:27324328-27324350 GAGAGGCAGTCTGGCTATGGCGG + Intergenic
1052968448 9:34361163-34361185 AAGAGGCAGGAGGGCCAATACGG + Intergenic
1054748702 9:68882235-68882257 AAGAGGCAATGTTGCAAAGAAGG + Intronic
1055037220 9:71830598-71830620 AAGACCCAGCCTGGCCAACATGG + Intergenic
1056385122 9:86090456-86090478 GAGAGGCAGTCTGGCCACAGTGG + Intronic
1056711364 9:88994391-88994413 AAGAGGCATCCTGCCCACGAAGG - Exonic
1057695714 9:97321823-97321845 AAGAGTCAGCCAGGCCAAGAGGG + Intronic
1058972430 9:110095846-110095868 AAGAAGCGGCCTGGCCAAGATGG - Intronic
1059227245 9:112683265-112683287 GAGAAGCAGCCTGGCCAACATGG + Intergenic
1059413627 9:114149747-114149769 AAGAGGCAGAAGGGCCCAGATGG + Intergenic
1059422110 9:114198691-114198713 AAGAGGCTGCCTGCCCGAGAAGG + Intronic
1059724383 9:116991770-116991792 GAGAGGCAGTCAGGGCAACATGG - Intronic
1060290508 9:122298341-122298363 AAGAGGCAGTCTGGAATACAGGG + Intronic
1061088814 9:128414977-128414999 AAGATGCAGGCAGGCCATGAAGG + Intronic
1061955516 9:133959386-133959408 AAGGAGCAGTCTGGCGCAGAGGG - Intronic
1061972624 9:134053173-134053195 CAGAGGCAGTCTTTCCAGGATGG + Intronic
1203475357 Un_GL000220v1:145292-145314 AAGAGGCGGTCAGACCAACAGGG + Intergenic
1186828177 X:13362843-13362865 TAGAGCCAGCCTGGCCAACATGG - Intergenic
1187114462 X:16334854-16334876 AAGAGGCTTTCAGGCCAACAAGG - Intergenic
1187220248 X:17318866-17318888 AGGAGTCAGCCTGGCCAACATGG - Intergenic
1187430525 X:19220048-19220070 AAGGGCCAGCCTGGCCAACATGG - Intergenic
1188731419 X:33650572-33650594 CAGAACCAGTCTGGCCAACATGG - Intergenic
1189486941 X:41441752-41441774 CAAAAGCAGCCTGGCCAAGATGG + Intergenic
1189848978 X:45160408-45160430 CAAAACCAGTCTGGCCAAGATGG - Intronic
1190831592 X:54063725-54063747 AAGACCCAGCCTGGCCAACATGG + Intergenic
1192506086 X:71684697-71684719 AAGAGGAAGTCTGACCCACATGG - Intergenic
1192520611 X:71796851-71796873 AAGAGGAAGTCTGACCCACATGG + Intergenic
1192662162 X:73052797-73052819 GAGAGGCAGTCTGGCCACAGAGG - Intergenic
1192703150 X:73497754-73497776 GAGAGGCAGTCTGGCCACATTGG + Intergenic
1192878611 X:75258547-75258569 GAGAGGCAGTCTGGCCACAGTGG - Intergenic
1193064142 X:77239904-77239926 CAAAAGCAGTCTGGCCAACATGG + Intergenic
1193081562 X:77411755-77411777 GAGAGGCAGTCTGGCTACAAAGG + Intergenic
1193206046 X:78748968-78748990 AAGTTGCACTCTTGCCAAGAAGG + Intronic
1193364883 X:80620329-80620351 AATAGACAGACTGGCCAAGGAGG - Intergenic
1194852856 X:98890713-98890735 AAGGGTCATTCTGGCCAAGGCGG + Intergenic
1196367788 X:114942928-114942950 GAGAGGCAGTCTGGCTAAAGCGG + Intergenic
1196369181 X:114956726-114956748 CATAGGCAGGTTGGCCAAGAAGG + Intergenic
1197767666 X:130069643-130069665 AAGAGGCATACTGGCCAAAGTGG - Exonic
1199379230 X:147148149-147148171 AATAGGCAGTGGAGCCAAGATGG - Intergenic
1199475092 X:148236198-148236220 AAGAGCCAGTCATGCAAAGATGG - Intergenic
1199909971 X:152275556-152275578 ATGAGCCAGCCTGGCCAACATGG + Intronic
1200540005 Y:4447024-4447046 AATTGGGGGTCTGGCCAAGATGG + Intergenic
1201633738 Y:16099022-16099044 AAGAGGCAGTCTGGCTACAGTGG - Intergenic
1202025733 Y:20520725-20520747 ACCAGCCAGTCTGGCCAACATGG - Intergenic