ID: 1044504984

View in Genome Browser
Species Human (GRCh38)
Location 8:93006744-93006766
Sequence TCCTGCCTAAAGAGGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 21, 2: 103, 3: 202, 4: 518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044504984_1044504986 5 Left 1044504984 8:93006744-93006766 CCAGACTGCCTCTTTAGGCAGGA 0: 1
1: 21
2: 103
3: 202
4: 518
Right 1044504986 8:93006772-93006794 ACTCCTCCCTCTTCACTGTGTGG No data
1044504984_1044504987 6 Left 1044504984 8:93006744-93006766 CCAGACTGCCTCTTTAGGCAGGA 0: 1
1: 21
2: 103
3: 202
4: 518
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data
1044504984_1044504988 7 Left 1044504984 8:93006744-93006766 CCAGACTGCCTCTTTAGGCAGGA 0: 1
1: 21
2: 103
3: 202
4: 518
Right 1044504988 8:93006774-93006796 TCCTCCCTCTTCACTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044504984 Original CRISPR TCCTGCCTAAAGAGGCAGTC TGG (reversed) Intronic
900084667 1:886200-886222 AACTGCTTAAAGAAGCAGTCTGG + Intergenic
900101364 1:963491-963513 TCCTGCCTGAACAGGTAGTTGGG + Exonic
901934246 1:12616959-12616981 ACCTGCCAAAAAAGACAGTCCGG + Intronic
902101808 1:13996591-13996613 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
902688193 1:18092562-18092584 TCTTCACCAAAGAGGCAGTCAGG - Intergenic
903597201 1:24503473-24503495 TCCTGCCTTCACAGGCAGGCTGG - Intronic
905264585 1:36742721-36742743 TCCTGCGGTAAGAGGCAGCCAGG + Intergenic
905952616 1:41964663-41964685 TCCCACCTAAAGAAGCAGTCTGG - Intronic
906426519 1:45718531-45718553 TCCATCCTAAGGAGGCACTCAGG - Intronic
906584650 1:46965692-46965714 ACCAGCTTAAAGAAGCAGTCTGG + Intergenic
906858295 1:49331543-49331565 TCTTGCTTAAAGAAGCAGTCTGG - Intronic
906858344 1:49331810-49331832 TCCTACTTAAAGAAGCAGTCTGG - Intronic
906903625 1:49864994-49865016 TCTGGCCTGAAGAGGCAGTCTGG - Intronic
906954302 1:50359456-50359478 TCTGGCCTAAAGAGGCAATGTGG - Intergenic
907838245 1:58131937-58131959 TGGTGCCTACAGAGGCAGGCAGG + Intronic
908450731 1:64252143-64252165 TCTCGCTTAAAGAAGCAGTCTGG - Intronic
908865826 1:68547871-68547893 TCCAACTTAAAGAAGCAGTCTGG - Intergenic
908910912 1:69071721-69071743 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
909303089 1:74038201-74038223 TCAGGCCTGAAGAGGCATTCTGG - Intronic
909374500 1:74924279-74924301 TCCTGCTTAAAGAAGCCGTCTGG - Intergenic
909677821 1:78257533-78257555 TTCGGCCTAAACAGGCAGCCTGG - Intergenic
909759588 1:79271254-79271276 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
909759645 1:79271530-79271552 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
910641950 1:89473336-89473358 CCCTACTTAAAGAAGCAGTCTGG - Intergenic
911149099 1:94580065-94580087 TCCTGCTTAAAGAAGCATTCTGG + Intergenic
911464368 1:98233360-98233382 TCCTGCTTAAATAAGCAGTCTGG - Intergenic
911836278 1:102623013-102623035 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
912344062 1:108947480-108947502 TTCTGGTTAAAGAGTCAGTCAGG + Intronic
912893188 1:113557447-113557469 TCCCGCTTAAAGAAACAGTCTGG - Intronic
913430815 1:118788928-118788950 TCCCAATTAAAGAGGCAGTCTGG - Intergenic
913704138 1:121401973-121401995 TGGAGCCTACAGAGGCAGTCAGG - Intergenic
914218483 1:145656037-145656059 TCCCACCTAAAGAAGCGGTCTGG + Intronic
914400615 1:147316718-147316740 CCAGGCCTGAAGAGGCAGTCTGG - Intergenic
914404611 1:147358354-147358376 CCTGGCCTAAATAGGCAGTCTGG - Intergenic
914471042 1:147978728-147978750 TCCCACCTAAAGAAGCGGTCTGG + Intronic
914979852 1:152404479-152404501 TCCAGCCTTAACAGGAAGTCTGG - Intergenic
915046172 1:153018719-153018741 TTCCACCTAAAGAAGCAGTCTGG - Intergenic
915104577 1:153525634-153525656 ACCTGCTTAAAAAAGCAGTCTGG - Intergenic
915497840 1:156294061-156294083 TCCTGCATTGAGGGGCAGTCAGG + Exonic
915639786 1:157215855-157215877 TCCTTCCTAAAGAAGTAGTCTGG + Intergenic
915659271 1:157388857-157388879 TCCTGCTTAAAGAAACAGCCTGG + Intergenic
915796971 1:158745999-158746021 TTCTGCTTACAGAGGCAGTAGGG + Intergenic
915990623 1:160512248-160512270 TCCAGCCTAAAGATGCAGTCTGG - Intronic
916183166 1:162105659-162105681 TCCTGCTTAAAGAAGAAGTCTGG + Intronic
916569032 1:166008886-166008908 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
916985935 1:170191544-170191566 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
917149553 1:171929544-171929566 ACCTGCTTAAAAAAGCAGTCTGG + Intronic
917269683 1:173258993-173259015 ACCTGCTTAATGAAGCAGTCTGG - Intergenic
917305269 1:173617780-173617802 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
917714584 1:177721688-177721710 ACCTGCTTAAAGAAGCAGTATGG - Intergenic
918697323 1:187560418-187560440 TCAGGGCTAAAGAGGCACTCTGG + Intergenic
918786370 1:188769245-188769267 TCCCACCTAAAGAAGAAGTCTGG - Intergenic
918943178 1:191027257-191027279 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
919251322 1:195059946-195059968 TACTGCATAAAGAGGTATTCTGG + Intergenic
921918708 1:220642376-220642398 TCCCACCTAAAGAAGCAGTCTGG - Intronic
921943116 1:220863813-220863835 CCTTGCCTAGAGAGGCAGTCTGG + Intergenic
922399611 1:225238872-225238894 TCCCTCTTAAAGAAGCAGTCTGG + Intronic
924412333 1:243819383-243819405 TCTGGCCTGAAGAGGCAGTCTGG - Intronic
1062761846 10:28414-28436 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1063831423 10:9958081-9958103 TGCAGCCTAAAGAGGCAGGCAGG - Intergenic
1067923211 10:50480903-50480925 TCTCACCTAAAGAAGCAGTCTGG - Intronic
1068186606 10:53593734-53593756 TCCTGTTTAAAGAAGCAATCTGG + Intergenic
1068811153 10:61257267-61257289 TCCCGCTTTAAGAAGCAGTCTGG + Intergenic
1068811202 10:61257506-61257528 TCTTCCCTAAAGAAGCAGTCTGG + Intergenic
1069360192 10:67633119-67633141 TCCTACTTAAAGAATCAGTCTGG - Intronic
1069370936 10:67747019-67747041 TCTGGCCTAAAGAGGCAATCTGG - Intergenic
1069759338 10:70797975-70797997 TCTTGCTTAAAGAAGCCGTCTGG + Intergenic
1069759396 10:70798235-70798257 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1070054690 10:72923727-72923749 ACCTGCTTAAAGAAGCAGTGTGG + Intronic
1070054741 10:72923989-72924011 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1070477771 10:76846732-76846754 TGCAGCCTACAGAGGCAGGCAGG - Intergenic
1070857601 10:79619735-79619757 CCCTGCTAAAAGAAGCAGTCTGG + Intergenic
1071235230 10:83638312-83638334 TCCTGCTTAATGAGGCTTTCAGG - Intergenic
1072253589 10:93600745-93600767 TCCTGCAGAAAGAGGCCCTCGGG + Exonic
1072382805 10:94892886-94892908 TGCAGCCTACAGAGGCAGGCAGG - Intergenic
1072402721 10:95122039-95122061 TCCAGCCTAAAAAGGCAGTCTGG + Intergenic
1072531905 10:96327531-96327553 TGCTGGTTAAAGAGGCTGTCTGG + Exonic
1073716611 10:106114992-106115014 TCCAGCCTAAGGAGGCAGTGTGG - Intergenic
1074022007 10:109593961-109593983 GCCTGCTTAAAGATGCAGTCTGG - Intergenic
1074270041 10:111944864-111944886 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1074769124 10:116722106-116722128 CCCTGCCTAATGAAGCAGGCAGG - Intronic
1075230421 10:120671620-120671642 TCTGGACTAAAGAGGCAGTTTGG - Intergenic
1075500140 10:122965503-122965525 ACCTACTTAAAGAAGCAGTCTGG - Intronic
1075860834 10:125675170-125675192 TCCAGCTTAAACAGGCAGTCTGG + Intronic
1075963414 10:126588334-126588356 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
1076055538 10:127369322-127369344 TCTTGCCTAAAGAGGAAATATGG + Intronic
1076393928 10:130124739-130124761 CACTCCCTGAAGAGGCAGTCTGG + Intergenic
1076726720 10:132417283-132417305 CCCTGGCTCACGAGGCAGTCGGG + Exonic
1077337994 11:2013976-2013998 TCCTGCCCACACAGGGAGTCAGG + Intergenic
1077508584 11:2943537-2943559 CCCTTCCTAAAAAGGCACTCTGG + Intergenic
1077756819 11:5039259-5039281 TCCTGATTTTAGAGGCAGTCTGG + Intergenic
1077855063 11:6116001-6116023 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1078033660 11:7780502-7780524 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1078612197 11:12830389-12830411 AGCTGCCTAAAGAGGTAGCCAGG - Intronic
1078691239 11:13582695-13582717 TACAACCTAAAGAGGTAGTCTGG - Intergenic
1078834564 11:15014802-15014824 ACCTGCTTAAATAGGTAGTCTGG - Intronic
1079580350 11:22055896-22055918 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1079588058 11:22150098-22150120 TCTGGCCTAAAGATACAGTCTGG + Intergenic
1079668473 11:23135992-23136014 ACCTGCTTAAAGAAGCAGTGTGG + Intergenic
1080214704 11:29827462-29827484 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1080292577 11:30687853-30687875 TACCGCTTAAAGAAGCAGTCTGG - Intergenic
1080513824 11:33001457-33001479 TCCGGCTTAAAGAAGCAGTCTGG + Intergenic
1080783125 11:35449471-35449493 TCCCACCTAAAGAAGCAGTCTGG + Intronic
1082757446 11:57092060-57092082 ACACGCTTAAAGAGGCAGTCTGG + Intergenic
1082993957 11:59233993-59234015 TCCCACCTAAAGAAGCAGCCAGG - Intergenic
1083062755 11:59891747-59891769 ACCTGCTTAAGGAAGCAGTCTGG + Intergenic
1085335110 11:75687610-75687632 TCCCGCTTAAGGAAGCAGTCTGG + Intergenic
1085335158 11:75687867-75687889 TCCTACCTAAAGAAGCAGTCTGG + Intergenic
1085744790 11:79105634-79105656 GCCTGCCAAATGAGGCAGGCTGG + Intronic
1086021774 11:82239375-82239397 ACCTACTTAAAGAAGCAGTCTGG + Intergenic
1086572115 11:88297107-88297129 TCCTGCCTTAGGAGACAGTAAGG - Intronic
1086610406 11:88748594-88748616 ACCTGCCCAGAGAAGCAGTCTGG - Intronic
1086726603 11:90193184-90193206 TTCTGCTTAAAGAGGCAATAAGG + Intergenic
1086991136 11:93304592-93304614 ACTTGCTTAAAGAAGCAGTCTGG - Intergenic
1087329008 11:96755859-96755881 TCCTGTTTAAAGAAGCATTCTGG + Intergenic
1087513511 11:99128380-99128402 TCCCACCTAAAGAAGCAGTCTGG - Intronic
1087606483 11:100384121-100384143 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1087606533 11:100384386-100384408 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1087606592 11:100384653-100384675 ATTTGCTTAAAGAGGCAGTCTGG - Intergenic
1087626635 11:100603661-100603683 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1087626687 11:100603919-100603941 TCCCATTTAAAGAGGCAGTCTGG - Intergenic
1087718570 11:101636590-101636612 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
1087977918 11:104573099-104573121 ACCTGCCTAAACAGGAAGTGTGG + Intergenic
1088008345 11:104969327-104969349 TCCCACCTAAAGAAGCAGTCTGG - Exonic
1088017843 11:105081883-105081905 TCCCACCTCAAGAAGCAGTCTGG - Intronic
1090688896 11:129156525-129156547 TCCTGCCTAGAGAGGCAGTCTGG - Intronic
1202820978 11_KI270721v1_random:69158-69180 TCCTGCCCACACAGGGAGTCAGG + Intergenic
1092398121 12:8146405-8146427 TCCCGCTTAACGAAGCAGTCTGG - Intronic
1092566728 12:9673795-9673817 TCCCACCTAAAGAGGCAGTCTGG + Intronic
1093086293 12:14869440-14869462 TACTGCTTAAAGAGGCAATCTGG + Intronic
1093340467 12:17967345-17967367 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1094273721 12:28645614-28645636 ACCTGCTTAAGGAAGCAGTCTGG + Intergenic
1094273769 12:28645850-28645872 TTCTACCTAAAGAAGCAGTCTGG + Intergenic
1094400046 12:30052755-30052777 TCCTGCCTACAGAAGCCGCCAGG - Intergenic
1094425320 12:30310686-30310708 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1094432057 12:30380287-30380309 TCCAGCCTAAAGAAGCAGTCTGG + Intergenic
1094694922 12:32809016-32809038 ACCCGCTTAAAGAAGCAGTCTGG + Intronic
1094811587 12:34143356-34143378 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1094842096 12:34346464-34346486 TGCCGCCTAAAGAGGCAGGGAGG - Intergenic
1095139574 12:38645267-38645289 TCATGCCTACATAGGCAGCCTGG + Intergenic
1095397850 12:41781061-41781083 ATCTGCCTGAAGAGGAAGTCAGG + Intergenic
1095416091 12:41978786-41978808 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
1096017094 12:48286503-48286525 TCCTGTCTAGAGAGGGAGTTGGG + Intergenic
1097455316 12:59792665-59792687 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1097455708 12:59796273-59796295 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1097521106 12:60672265-60672287 ACCTGCTTAAAGAAGTAGTCTGG + Intergenic
1097582960 12:61481078-61481100 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1097643120 12:62205582-62205604 TCCAGCCTAAAGAGGGAGTCTGG + Intronic
1097748957 12:63330983-63331005 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1098128344 12:67322894-67322916 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1098201835 12:68064242-68064264 TTCAGCCTAAAAAGGCAGTCTGG + Intergenic
1098829962 12:75350129-75350151 TCTCGCTTAAAGAAGCAGTCTGG - Intronic
1099590013 12:84575213-84575235 TATGGCCTAAAGAGGCAGTCAGG - Intergenic
1099684316 12:85865957-85865979 TCAGGCCTGAAAAGGCAGTCTGG + Intergenic
1099719396 12:86341754-86341776 GCCTGCTTAAAGCAGCAGTCAGG - Intronic
1099926440 12:89024311-89024333 GCCTCCCTAAAGTGTCAGTCTGG + Intergenic
1100115101 12:91294604-91294626 TCCTACTTAAAGAGGCAGTCTGG - Intergenic
1100156454 12:91805111-91805133 TCCTACCTAAAGAAGCAGCCTGG - Intergenic
1100411418 12:94322947-94322969 ACCTGCATAAAAAAGCAGTCTGG + Intronic
1100941094 12:99723385-99723407 TCAGGCCTGAAGAGGCACTCTGG - Intronic
1101187227 12:102292076-102292098 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
1103098052 12:118147799-118147821 ACCTGCCTGAGGAGGCAGTAAGG - Intergenic
1105231903 13:18503996-18504018 TGGAGCCTAAAGAGGCAGGCAGG - Intergenic
1105316888 13:19273520-19273542 TGGAGCCTACAGAGGCAGTCAGG - Intergenic
1105335056 13:19459741-19459763 TCCTGCTTAAAGAAGCAGTCTGG + Intronic
1105668461 13:22586597-22586619 TCCAGCCTGAAGAAGCAATCTGG + Intergenic
1105859867 13:24399647-24399669 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1107119180 13:36778792-36778814 TCCTGTTTAAAGAAGCAGTCTGG - Intergenic
1107314797 13:39119693-39119715 TCCCACCTAAAGAAGCAGTCTGG + Intergenic
1107661331 13:42642828-42642850 ACCTGCTTAATGAAGCAGTCTGG + Intergenic
1107661383 13:42643108-42643130 TCCCACCTAAAGAAGCGGTCTGG + Intergenic
1109072507 13:57787331-57787353 ACCGGCCTAAAGAAGCAGTCTGG + Intergenic
1109097282 13:58134251-58134273 CCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1109146878 13:58790544-58790566 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1109278478 13:60328509-60328531 TCCTGCACACAGAGGAAGTCAGG - Intergenic
1109320612 13:60805482-60805504 TGCAGCCTACAGAGGCAGGCAGG + Intergenic
1109361521 13:61299808-61299830 ACCTGCTTAAAGAAACAGTCTGG - Intergenic
1109968761 13:69737629-69737651 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1110015531 13:70396511-70396533 CCCTCCCTAAAGAAGCTGTCAGG - Intergenic
1110639733 13:77808811-77808833 AACTCCCTAAAGAGGCAGCCAGG - Intergenic
1110790490 13:79581939-79581961 TCAGGCCTAAAGAGGCGCTCTGG + Intergenic
1110808766 13:79789440-79789462 ACCTGCTTAAAAAGGAAGTCTGG - Intergenic
1111235294 13:85400927-85400949 TCCTGCTTAAAGAAGAAATCTGG + Intergenic
1111641633 13:90977438-90977460 TCTTGCTTAAAGAAGCAGTCTGG - Intergenic
1112076168 13:95915788-95915810 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1112076210 13:95916053-95916075 ACCTGCTTAAAGAGGCAGTCTGG - Intronic
1112913831 13:104522447-104522469 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1114058855 14:19001094-19001116 GCCTGCTTACAGAAGCAGTCTGG - Intergenic
1114103689 14:19400660-19400682 GCCTGCTTACAGAAGCAGTCTGG + Intergenic
1114260629 14:21033712-21033734 TCCTGACTTACGAGGCAGGCAGG - Exonic
1114744383 14:25132244-25132266 TCCTGGGTAGAGAGGCAGTGAGG + Intergenic
1115927214 14:38449087-38449109 TTCAGCCTAAAGAGGCAGTCTGG - Intergenic
1116123913 14:40756886-40756908 ACCTGCTTAAAGAAGCAGTTGGG - Intergenic
1116312317 14:43342382-43342404 TCCCACCTAAAGAAGCAGTCTGG + Intergenic
1116320406 14:43454775-43454797 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1116428641 14:44820622-44820644 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1116493684 14:45536121-45536143 ACCTGCTTAAAGGAGCAGTCTGG + Intergenic
1116677072 14:47919910-47919932 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1116685700 14:48035862-48035884 TCTGTCCTGAAGAGGCAGTCTGG + Intergenic
1117641096 14:57800011-57800033 TCCGGCTTAAAGAAGCAGTCTGG - Intronic
1117829193 14:59733391-59733413 CCCTGCTTAAAGAAGCAGTCTGG - Intronic
1117829245 14:59733643-59733665 TCCCACTTAAAGAAGCAGTCTGG - Intronic
1117936586 14:60913924-60913946 TAGAGCCTACAGAGGCAGTCTGG + Intronic
1118478898 14:66144050-66144072 TCAGGCCTGAAGAGGCACTCGGG - Intergenic
1118527371 14:66661407-66661429 TCCCTCTTAAAGAAGCAGTCTGG - Intronic
1118763735 14:68896261-68896283 TCCTGCCTGTAGGGGGAGTCAGG - Intronic
1118957578 14:70497178-70497200 ACCTGCTTAAAGCAGCAGTCTGG - Intergenic
1120365360 14:83561637-83561659 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1120369011 14:83607896-83607918 TGTGGTCTAAAGAGGCAGTCGGG + Intergenic
1120799117 14:88669480-88669502 TCCGACCTAAAGAGGCAGTCTGG - Intronic
1121115223 14:91338565-91338587 TCCTCCCTGCAGAGGCAGTAAGG + Exonic
1121142407 14:91555030-91555052 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1121706793 14:96002349-96002371 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
1124196931 15:27639543-27639565 TCCTGCCTAAAGAGGCACTCTGG - Intergenic
1124923445 15:34048174-34048196 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1125054520 15:35341855-35341877 ACCTGCTTAAAGAAGCAGCCTGG + Intronic
1125216641 15:37283047-37283069 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1125984755 15:44039120-44039142 CCCTGCCTAGAGAGGCAGTCTGG - Intronic
1126219555 15:46197136-46197158 ACCTGCTTAAATAAGCAGTCTGG + Intergenic
1126236739 15:46394612-46394634 TCCTACCTAAAGAAGCAGTCTGG - Intergenic
1126784256 15:52163730-52163752 ACCCGCTTAAAGAAGCAGTCTGG - Intronic
1127012220 15:54643021-54643043 TCTTGCTTAAAGAAGCAGTCTGG - Intergenic
1127687706 15:61364871-61364893 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1128002122 15:64202851-64202873 TCCAGTCTAAAGAGTCAGCCTGG - Intronic
1128014131 15:64327186-64327208 TGGAGCCTAAAGAGGCAGGCAGG - Intronic
1128615125 15:69102922-69102944 TCCTGCCTGAAGAGGGAAGCAGG - Intergenic
1129566957 15:76633417-76633439 TCTTGCTTAAATAAGCAGTCTGG + Intronic
1129567013 15:76633677-76633699 TCCTGCTTAAAGAAGCAGTCTGG + Intronic
1129935983 15:79450730-79450752 GCCTGCCTAAAGCGGGATTCTGG - Intronic
1131600741 15:93846361-93846383 TCCAGCCTAAAGAGGTAATCTGG - Intergenic
1135995235 16:27243007-27243029 TGATGCCTACAGAGGCAGGCAGG + Intronic
1136643518 16:31588776-31588798 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1136645269 16:31608577-31608599 TCTGGCCTGAAGAGGCACTCTGG - Intergenic
1136659984 16:31749213-31749235 TCAGGCCTGAAGAGGCACTCTGG + Intronic
1136662095 16:31772015-31772037 TCTGGCCTAAAGAGGCAGTCTGG - Intronic
1138882334 16:61031172-61031194 TCCAGCCTAAAGAGGGAGTCTGG + Intergenic
1140182712 16:72736321-72736343 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
1142526371 17:544507-544529 TCCTGCATAAAGAGGCACTGTGG + Intronic
1142837192 17:2595162-2595184 TCTTTCCTTAAGTGGCAGTCCGG + Intronic
1142916325 17:3142254-3142276 TCCAGCCTAAACAGGCAGTCTGG + Intergenic
1143324992 17:6092876-6092898 GCCTGCCCAAAGAGGCAGCTAGG - Intronic
1143973482 17:10812933-10812955 TCATGGCTAGAGAGGCAGTTAGG - Intergenic
1144431779 17:15198945-15198967 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1145775519 17:27525282-27525304 TCCTGGCAATAGGGGCAGTCTGG - Intronic
1146571395 17:33956407-33956429 TCCTGACTGAAGGGGCAGCCAGG - Intronic
1146572107 17:33961776-33961798 TCCTGCCTGAAGGGGCAGCCAGG - Intronic
1146802018 17:35832329-35832351 TCCTGCTTAAAAAGGCATCCTGG + Intronic
1147460998 17:40568924-40568946 TCCTGCTTAAAAAAACAGTCTGG - Intergenic
1147640572 17:41996270-41996292 TTCTGTCAAAAGAGGCAGTATGG - Intronic
1147963973 17:44183491-44183513 TCCTCCCTAGAGAGGGAGGCTGG + Intergenic
1148197916 17:45728090-45728112 GCCTGCCTAAAAGGGGAGTCGGG - Intergenic
1148212808 17:45818413-45818435 CCCTGCCTGAAGTGGCAGTCAGG + Intronic
1148402284 17:47375656-47375678 TCCTCCCTAAAGAGGGCATCTGG - Intronic
1149359995 17:55885046-55885068 CCCTGCGTAGAGAGGCAGTCTGG - Intergenic
1149377940 17:56064486-56064508 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1150190487 17:63233007-63233029 TCTGGTCTAAAAAGGCAGTCTGG + Intronic
1152037565 17:77882835-77882857 CCCTGCCTAAAGAGACAGTCAGG - Intergenic
1152350827 17:79783282-79783304 TCCAGACCAGAGAGGCAGTCAGG - Intronic
1152736329 17:81999122-81999144 TTGTGCCAAAAGAGGCAGACTGG + Intronic
1152954753 18:28744-28766 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1153785243 18:8528674-8528696 ACCTGCTTAAAGCAGCAGTCTGG - Intergenic
1153785298 18:8528942-8528964 GCCTGCATAAAGCAGCAGTCTGG - Intergenic
1153858386 18:9173732-9173754 ACCTGCTTAAAGATGCAGTCTGG + Intronic
1155091335 18:22514716-22514738 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1155117510 18:22784015-22784037 TCCAGCCTAGAGAGGCAGTCTGG + Intergenic
1155343194 18:24833412-24833434 TCTGGCTGAAAGAGGCAGTCTGG - Intergenic
1155429834 18:25743819-25743841 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
1155464499 18:26120305-26120327 TCCTGCTTAAATAAGCAGTCTGG - Intergenic
1155660292 18:28240966-28240988 TGGAGCCTAAAGAGGCAGGCAGG - Intergenic
1155762895 18:29588910-29588932 TCCGTCCTAAAGAGGCAGTCTGG - Intergenic
1156778481 18:40822026-40822048 TCAGGCCTGAAGAGGCATTCTGG - Intergenic
1157067864 18:44373478-44373500 ACCTGCCTAAAGAAGCAGTCTGG + Intergenic
1158105646 18:53882550-53882572 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1158676981 18:59529221-59529243 TCCAGCCCAAAGAGGCAGTCTGG + Intronic
1159387277 18:67742429-67742451 TCCCACATAAAGAAGCAGTCTGG - Intergenic
1159584556 18:70271425-70271447 TCATTCCTACAAAGGCAGTCTGG - Intergenic
1161961107 19:7523570-7523592 TCCTGCCTAGCAAAGCAGTCAGG - Intronic
1163779412 19:19238549-19238571 TCATGCATTAAGAAGCAGTCAGG - Intronic
1164121092 19:22266024-22266046 TCTGGCCTAAAGAGAGAGTCAGG - Intergenic
1164152347 19:22566028-22566050 CCCTGCCTAGAGAGGCAGACTGG + Intergenic
1164178848 19:22802187-22802209 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1164265290 19:23610318-23610340 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1166588184 19:43969648-43969670 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1166911766 19:46164030-46164052 ACCTGCTTAAAGAAACAGTCTGG + Intergenic
1168164283 19:54536037-54536059 TACTGCTTAAAGAGGCAGGAGGG + Intronic
925433184 2:3814797-3814819 TCAGGCCTAAAGAGGCACTCCGG + Intronic
926987387 2:18639552-18639574 AGCTGCTTAAAGAAGCAGTCTGG + Intergenic
927021296 2:19020184-19020206 CCCTGCCCAGAGAGGCAGTCTGG + Intergenic
928757571 2:34545424-34545446 TCTGGCCTGAAGAGGCAATCTGG + Intergenic
928883358 2:36122216-36122238 GCCTGCTTAAAGAAGCAGTTTGG + Intergenic
930229371 2:48827634-48827656 ACCTGCTTAAAAAAGCAGTCTGG - Intergenic
930264702 2:49186189-49186211 CCCTGCCCAGAGAGGCAGTCTGG + Intergenic
930424261 2:51193748-51193770 ACCTGCCCAAAGAATCAGTCTGG + Intergenic
930424304 2:51194012-51194034 TCCTGCCTATAGAAGCAGTCTGG + Intergenic
930424360 2:51194278-51194300 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
930545776 2:52765885-52765907 TTATGCCTGAAGAGGCACTCTGG - Intergenic
931560413 2:63555229-63555251 TCCGGCCTCAAGAGGCAGTCTGG - Intronic
932276191 2:70453958-70453980 TCCTGCCCACAGAGGGAGGCAGG - Intronic
932379651 2:71270350-71270372 ACCCGCTTAAAGAAGCAGTCTGG - Intergenic
932747717 2:74347928-74347950 TCCTCCCCAAAGGGGCAGACTGG + Intronic
933237579 2:79882465-79882487 TCAGGCCTGAAGAGGCACTCTGG + Intronic
934479114 2:94618707-94618729 TTCCGCCTAAAAAAGCAGTCTGG + Intergenic
934622867 2:95826195-95826217 GTCAGCCTAAAGAGGCAGTCTGG + Intergenic
934623333 2:95829726-95829748 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
934623568 2:95831376-95831398 ACCCACTTAAAGAGGCAGTCTGG - Intergenic
934810426 2:97272365-97272387 ACCTACTTAAAGAAGCAGTCTGG - Intergenic
934810902 2:97275908-97275930 GTCAGCCTAAAGAGGCAGTCTGG - Intergenic
934826790 2:97432031-97432053 GTCAGCCTAAAGAGGCAGTCTGG + Intergenic
934827266 2:97435574-97435596 ACCTACTTAAAGAAGCAGTCTGG + Intergenic
934923685 2:98366639-98366661 TTTAGCCTAAAGAGGCAGTCTGG + Intronic
935489395 2:103698286-103698308 TCCCAGCTAAAGAGGCAGTCTGG + Intergenic
935834542 2:107036696-107036718 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
935952651 2:108345121-108345143 TCCAGCCTAAAGAGGTAGTCTGG + Intergenic
936750417 2:115634968-115634990 TCCAGCCTAAAGAGGCAATCTGG + Intronic
936849084 2:116873969-116873991 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
937052114 2:118901245-118901267 TGCAGCCTACAGAGGCAGGCAGG + Intergenic
937610526 2:123855829-123855851 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
938282340 2:130073137-130073159 GCCTGCTTACAGAAGCAGTCTGG + Intergenic
938332969 2:130461709-130461731 GCCTGCTTACAGAAGCAGTCTGG + Exonic
938356840 2:130658962-130658984 GCCTGCTTACAGAAGCAGTCTGG - Intergenic
938433275 2:131265768-131265790 GCCTGCTTACAGAAGCAGTCTGG - Intronic
938477320 2:131628354-131628376 GCCTGCTTACAGAAGCAGTCTGG - Intergenic
938520777 2:132068476-132068498 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
938718490 2:134043282-134043304 TGCAGCCTACAGAGGCAGGCAGG - Intergenic
939109723 2:137992452-137992474 TCAGGCCTGAAGAGGCACTCTGG - Intronic
939180153 2:138794725-138794747 TCCAGCTTAAAGAAGCAGTCTGG + Intergenic
939192417 2:138931919-138931941 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
939391124 2:141570793-141570815 TCAGGCCTGAAGAGGCACTCTGG - Intronic
939398366 2:141660565-141660587 TCCAGACTAAAGAGGTAGTCTGG - Intronic
939852646 2:147319353-147319375 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
940057126 2:149525374-149525396 TCCCTCTTAAAGAAGCAGTCTGG + Intergenic
940189245 2:151021658-151021680 TCCTTCCCAAAGAGGAAGTCTGG + Intronic
940410734 2:153360608-153360630 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
941136400 2:161722926-161722948 TCCGACCTAAAGAAGCAGTCTGG + Intronic
941546169 2:166854229-166854251 TGCAGCCTACAGAGGCAGGCAGG - Intergenic
941962886 2:171271000-171271022 TCTTGGCTAAAGAGACACTCAGG - Intergenic
942856517 2:180555709-180555731 TCCGGCCTAAAAAGGCAGTCTGG - Intergenic
943250741 2:185518677-185518699 TCCAGCCTAAAGATGCAGTCTGG + Intergenic
943350022 2:186785930-186785952 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
944363731 2:198891960-198891982 ACCTGCTTAAAGAAGCAGTTTGG - Intergenic
944439406 2:199727158-199727180 TCCTACCTAAAGAAGCAGTCTGG + Intergenic
945024336 2:205606000-205606022 TCCAGCCTAAAGAGGCAGTCTGG + Intronic
945524012 2:210866108-210866130 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
945533743 2:210986902-210986924 CCTTGCCTAGAGAGGCAGTCTGG + Intergenic
945714157 2:213336872-213336894 ACCTGCTTAAATAAGCAGTCTGG - Intronic
945974199 2:216258166-216258188 CCCTCCCCAAAGAGGCAGTCAGG - Exonic
947098328 2:226591892-226591914 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
947449462 2:230194013-230194035 TCCAGCCTAGGGAGGCAGTGGGG + Intronic
947480090 2:230491420-230491442 TCAGGCCTGAAGAGGCACTCTGG + Intronic
947690357 2:232129967-232129989 TCCTGAGGAAAGAGGCAGTTAGG - Intronic
948091631 2:235300932-235300954 TCTTGCCTAAAAAGGAGGTCAGG - Intergenic
1169672128 20:8114371-8114393 TGGAGCCTACAGAGGCAGTCAGG + Intergenic
1169695760 20:8385281-8385303 TCAGGCCTGAAGAGGCACTCTGG + Intronic
1170011472 20:11728381-11728403 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1170496605 20:16931025-16931047 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1171816817 20:29792945-29792967 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1171882645 20:30629659-30629681 GCCTGCTTACAGAAGCAGTCTGG + Intergenic
1174180243 20:48669905-48669927 TCATGGGTAAAGAGGCTGTCTGG - Intronic
1174992149 20:55522785-55522807 TCTGGCCCAAAGAGGCAGTCTGG + Intergenic
1175176040 20:57112695-57112717 TCCTTCCTAAAGAGACAACCCGG + Intergenic
1175298100 20:57923279-57923301 TTCTGCCCAAGAAGGCAGTCTGG - Intergenic
1175591940 20:60200351-60200373 TTCAGCCTAAAGAGGCAGTCTGG + Intergenic
1176522945 21:7838469-7838491 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1176738524 21:10575251-10575273 TCCTGCTTAAAGAGGCAGTCTGG - Intronic
1176775877 21:13132297-13132319 TGGAGCCTAAAGAGGCAGGCAGG - Intergenic
1177388103 21:20433329-20433351 TCTGGCCTGAAGAGGCAGTCAGG - Intergenic
1177511372 21:22091793-22091815 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1177692795 21:24532476-24532498 TGCTGCCTAAAGAGGCCCTTGGG + Intergenic
1177956582 21:27606152-27606174 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1178656965 21:34468481-34468503 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1179292155 21:40028324-40028346 TGCAGCCTACAGAGGCAGGCAGG + Intronic
1179822947 21:43947342-43947364 TCCAGCCCAAAGCTGCAGTCAGG + Intronic
1180250316 21:46581934-46581956 GCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1180320288 22:11313553-11313575 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1180334893 22:11568980-11569002 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1180477340 22:15723710-15723732 GCCTGCTTACAGAAGCAGTCTGG - Intergenic
1182194984 22:28506561-28506583 AACTGCTTAAAGAAGCAGTCTGG - Intronic
1183902704 22:41018550-41018572 TCCTGCCTGAAGAGGCAGATGGG + Intergenic
949406522 3:3719910-3719932 TGCAGCCTACAGAGGCAGGCAGG - Intronic
949592737 3:5510703-5510725 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
950471661 3:13190132-13190154 TCCTGCCTGAACAGCCTGTCTGG + Intergenic
950587422 3:13904452-13904474 TCCTGCTTAAAAAAGCAGTCTGG - Intergenic
951026254 3:17833786-17833808 TCCTGCATAAAGAGAGAATCAGG + Intronic
951386792 3:22052978-22053000 TGGAGCCTACAGAGGCAGTCAGG + Intronic
951432865 3:22628265-22628287 TCCAGCCTAAAGAGACAGTCTGG + Intergenic
951469756 3:23043944-23043966 GCCTGCTTAAAGAGGCAGTCTGG - Intergenic
951951433 3:28203090-28203112 TCAGTCCTAAAGAGGCATTCTGG - Intergenic
951996535 3:28736262-28736284 ACCTGCCTAAAGAAGCAGTCTGG + Intergenic
952572292 3:34731903-34731925 TCTGGCCTAAGGAGGCAGTCTGG - Intergenic
952616420 3:35278595-35278617 ACCCGCCCAAAGAAGCAGTCTGG - Intergenic
952634017 3:35505488-35505510 TCTGGCCTGAAGAGGCACTCTGG - Intergenic
952673606 3:36000370-36000392 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
952679370 3:36073781-36073803 ACCTGCTTAAAGAAGCAATCTGG + Intergenic
952695825 3:36264312-36264334 TCCTGCTTAAAGAAGTAGTCTGG + Intergenic
953052939 3:39362232-39362254 GTCTGCTTACAGAGGCAGTCTGG - Intergenic
953337304 3:42104210-42104232 GCCTCCCTACAGAGGCAGGCAGG - Intronic
953816606 3:46163292-46163314 TCCCGCTTAAAGAAGCAGTCTGG + Intergenic
954247369 3:49342118-49342140 TCCTGCCTTAAAAGGCAGGCAGG + Intergenic
954529251 3:51304168-51304190 TCCGACCTAAAGTGGCAGCCTGG + Intronic
955681384 3:61505454-61505476 ACCAGCTTAAAGAAGCAGTCTGG + Intergenic
955961131 3:64342390-64342412 TCCTGCCTAAGGAGACAGTAAGG - Intronic
956157919 3:66317863-66317885 TCCTGCTTAAAGAATCAGTCTGG + Intronic
956158287 3:66321197-66321219 TCCTACCTAAATCGGAAGTCTGG + Intronic
956262352 3:67358017-67358039 AACTGCCTATAGAGGGAGTCAGG - Intergenic
956374884 3:68603627-68603649 TCCAGCTTAAAGAGGCAATCTGG - Intergenic
957268858 3:78003190-78003212 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
957690068 3:83555746-83555768 ACTTGCTTAAAGAAGCAGTCTGG + Intergenic
958527956 3:95287418-95287440 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
958590589 3:96154185-96154207 TTCTGCTTAAAGAAGCAGTCTGG - Intergenic
958650591 3:96931536-96931558 TCCCACTTAAAGAAGCAGTCTGG + Intronic
959263924 3:104114114-104114136 TCCTGCTTAAAGAAGCATTCTGG - Intergenic
959883531 3:111473640-111473662 TCCAGCCTAAATAGGCAGTCTGG + Intronic
959898075 3:111627654-111627676 ACCTGCTTAAAGATGCAGTCTGG - Intronic
960277235 3:115742179-115742201 TACGGCCTAAAGAGTCAGTCTGG + Intergenic
960680090 3:120238774-120238796 ACCTGCCTCAAGAAGCAGTCTGG + Intronic
960680151 3:120239036-120239058 TCCCACTTAAAGAAGCAGTCTGG + Intronic
960764624 3:121111982-121112004 TCCAGCTTAAAGAGGCAGTATGG + Intronic
962532995 3:136301018-136301040 TTCTGCCTAAAGTGACCGTCTGG + Exonic
963400460 3:144791063-144791085 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
963531383 3:146476745-146476767 TCTGCCCTAAAGAGGCAGTCTGG - Intronic
964183342 3:153913636-153913658 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
964255733 3:154772569-154772591 TCCTGCTTAAAAAACCAGTCTGG + Intergenic
964295162 3:155225425-155225447 TCTGGCCTAAAGAGGTAGTCTGG + Intergenic
965288810 3:166849749-166849771 TCTGGCGTAAAGAGGCAGTCTGG + Intergenic
965317684 3:167211715-167211737 ACCTGCTTAAAGTAGCAGTCTGG - Intergenic
966269808 3:178091005-178091027 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
966300999 3:178479916-178479938 TCCTGACAAAGGAGGCAGTCGGG - Intronic
966454830 3:180102752-180102774 ACCTGCTTAAAGAATCAGTCTGG - Intergenic
966539628 3:181075115-181075137 TCAGGCCTGAAGAGGCAATCTGG + Intergenic
967397304 3:189022707-189022729 TGGAGCCTAAAGAGGCAGGCAGG + Intronic
967503170 3:190223145-190223167 ACCTGCTTAAAGCAGCAGTCTGG + Intergenic
967879136 3:194286925-194286947 TCCTGCCTCCAGAGGCAGCCCGG + Intergenic
968404438 4:327572-327594 GCCTACTTAAAGAAGCAGTCTGG - Intergenic
968426770 4:528921-528943 TCCTGGCTACAGAGGCATCCTGG + Intronic
968696665 4:2033702-2033724 ACCTGCTTAAGGAAGCAGTCTGG + Intronic
968696722 4:2033964-2033986 TCCCAGTTAAAGAGGCAGTCTGG + Intronic
969154521 4:5198669-5198691 TCCTGCCTAAAGAGGGAGTGTGG - Intronic
970106909 4:12595456-12595478 TCCCACCTAAAGAAGCATTCTGG - Intergenic
970106957 4:12595719-12595741 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
970666500 4:18342960-18342982 TCAGGCCTAAAGAGGCCCTCTGG + Intergenic
970952735 4:21775718-21775740 TTATGCCTGAAGAGGCACTCTGG + Intronic
971105877 4:23524116-23524138 ACCTGCTTAAAGCAGCAGTCTGG - Intergenic
971107411 4:23542058-23542080 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
971574303 4:28254144-28254166 ACCTGCTTAAAGAAGCTGTCTGG - Intergenic
972861017 4:43169261-43169283 TCCCACTTAAAGAGGCAGTCTGG - Intergenic
973018706 4:45172729-45172751 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
973262473 4:48178750-48178772 CCCTGCCTACAGACGCATTCAGG + Intronic
973284817 4:48403455-48403477 TCCCACTTAAAGAAGCAGTCTGG + Intronic
973366318 4:49212096-49212118 GCCTGCTTACAGAAGCAGTCTGG + Intergenic
973545135 4:51973498-51973520 TCCCACCTAAAGAAGCAATCTGG + Intergenic
974181210 4:58386641-58386663 TCCAGCCTGAAGAGGCACTCTGG + Intergenic
974182450 4:58401367-58401389 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
974249244 4:59363044-59363066 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
974499699 4:62684228-62684250 TCTGGACTAAAGAGGCAGTCTGG - Intergenic
974641997 4:64642955-64642977 TCCTGCCTAAAGAGAAAATGAGG + Intergenic
974899685 4:67981976-67981998 ACCTGCTTAAAGAAACAGTCTGG + Intergenic
974913252 4:68148620-68148642 TCTGGCCTAAGGAGGAAGTCTGG + Intergenic
974986090 4:69027225-69027247 ACCTGCTTAAAGAAGCAGTCTGG + Intronic
975021916 4:69501304-69501326 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
975153537 4:71045743-71045765 ACCTGCCCAAAGAAGCAGTCTGG - Intergenic
975489847 4:74976342-74976364 TCCCACCTAAAGAAGCAGTCTGG - Intronic
975601821 4:76108590-76108612 TACTGCCCCAAGAGGCAGTTTGG - Intronic
975977463 4:80115698-80115720 GCCTGCTTTAAGACGCAGTCTGG - Intronic
976030784 4:80751311-80751333 ACCTGCTTAAAGAAGCAGTATGG + Intronic
976375670 4:84342536-84342558 TTTGGCCTAAAGAGGCAGTCTGG - Intergenic
976527868 4:86114920-86114942 TTCCACCTAAAGAAGCAGTCTGG + Intronic
976858345 4:89630759-89630781 TCTTCCCTGAAGAGCCAGTCAGG - Intergenic
977084427 4:92575946-92575968 TCCCCCTTAAAGAAGCAGTCTGG + Intronic
977213298 4:94246517-94246539 TCCAGTCTAAAGAGGCAGATAGG + Intronic
977467731 4:97403064-97403086 ACCTATCTAGAGAGGCAGTCTGG + Intronic
977506737 4:97911839-97911861 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
977524276 4:98125659-98125681 ACCTGCTTAAAGAAGCAGTCTGG + Intronic
977631448 4:99247900-99247922 CCCTGCCCATAGAGGTAGTCTGG + Intergenic
977657259 4:99536475-99536497 TCCCACTTAAAGAAGCAGTCTGG + Intronic
977678598 4:99774299-99774321 TCCTGCTTAAAGGAACAGTCTGG - Intergenic
978118445 4:105049983-105050005 TCCTACTTAAAGAAGTAGTCAGG - Intergenic
978327899 4:107579595-107579617 TCTGGCCTAAAAAGACAGTCTGG - Intergenic
978683890 4:111415729-111415751 ACCTGCCTAAAGCAGCAGCCTGG + Intergenic
978940414 4:114429405-114429427 TCCAGCCTAAAGAGTCAGTCTGG + Intergenic
979096937 4:116563058-116563080 TCATGCTTAAAGAAACAGTCTGG - Intergenic
979152783 4:117341527-117341549 TCCTACTTAAAGAAGCAGTCTGG + Intergenic
979512253 4:121567737-121567759 CCCTGACTAGAGAGGCAGTCTGG - Intergenic
979576099 4:122293956-122293978 TCCCACTTAAAGAAGCAGTCTGG - Intronic
979576156 4:122294258-122294280 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
979732820 4:124045296-124045318 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
979735049 4:124072961-124072983 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
980508913 4:133759745-133759767 TCCTGTCTGAAGAGGCAATCTGG + Intergenic
980517098 4:133877699-133877721 ACCTGCGTAAAAAAGCAGTCTGG + Intergenic
980645329 4:135636003-135636025 TCCTGCTTAAATAAGCAGTCTGG + Intergenic
981273831 4:142874976-142874998 TCTGGTCTAAAGAGGCAGTTGGG - Intergenic
981534183 4:145782272-145782294 GCCTGGCGGAAGAGGCAGTCGGG + Intronic
981790937 4:148535879-148535901 TCCTTCTTAAAGAAGCAGTCTGG + Intergenic
982372290 4:154647251-154647273 TCTAGCCTAAAGAGGAAATCTGG - Intronic
982586126 4:157242199-157242221 TCTTCTCTAAAAAGGCAGTCAGG + Intronic
982859866 4:160435010-160435032 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
983684502 4:170391971-170391993 TCCTACCTAAAGTGGCAGACAGG + Intergenic
983753320 4:171303260-171303282 ACCTGCTTAAGGAAGCAGTCTGG - Intergenic
983774912 4:171594794-171594816 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
983820923 4:172192907-172192929 TCCCACCTAAAGAAGCAGGCTGG - Intronic
983899009 4:173113277-173113299 ACTTGCTTAAAGAAGCAGTCTGG - Intergenic
983957594 4:173715945-173715967 TCCCACCTAAAGAGGCAGTCTGG - Intergenic
986011903 5:3724481-3724503 TCCAGCCTAAAGAGGTTGTCTGG + Intergenic
986753567 5:10812407-10812429 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
986915433 5:12613672-12613694 TCCTACTTAAAGAAGCAGTCTGG + Intergenic
987399835 5:17463759-17463781 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
987416015 5:17662955-17662977 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
987530681 5:19115223-19115245 GCTTGCCTGAAGAAGCAGTCTGG - Intergenic
987906720 5:24087886-24087908 TCCCACTTAAAGAAGCAGTCTGG - Intronic
987906772 5:24088153-24088175 TCCTGCATAAAGATGCATTCTGG - Intronic
987919815 5:24264780-24264802 ACCCGCTTAAAGAAGCAGTCTGG - Intergenic
988076577 5:26362508-26362530 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
989276804 5:39598954-39598976 TCCAGCCTAAAGAGGCAGTCCGG + Intergenic
989348210 5:40453670-40453692 TCAGGCCTGAAGAGGCATTCTGG + Intergenic
989676681 5:43981500-43981522 TCCAGCCTGAAGAGGCAATCTGG + Intergenic
990359896 5:55007649-55007671 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
990620108 5:57550184-57550206 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
990940730 5:61200575-61200597 TCTGGCCTAAAGAGTCAGTCTGG + Intergenic
991149195 5:63346548-63346570 TCCTCAGAAAAGAGGCAGTCAGG - Intergenic
991468488 5:66941218-66941240 TAGTTCCTAAAGAGGGAGTCAGG + Intronic
993020414 5:82584718-82584740 TCCAGCTTAAAGAAGCAGTCTGG + Intergenic
993243109 5:85415719-85415741 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
993365527 5:87030186-87030208 TCCTACTTAAAGAAGCAGTCTGG + Intergenic
993375884 5:87149260-87149282 GCCTGCTTAAAGAAGCAGTCTGG + Intergenic
993837646 5:92835060-92835082 TCCAGCCTAAAGAGTCAGTCTGG + Intergenic
994205676 5:97033023-97033045 TATTGCCTAAATAGGCAGTAAGG - Exonic
994346739 5:98696570-98696592 ACCTGCTTAAAGAAGAAGTCTGG + Intergenic
994696616 5:103079796-103079818 TCTGGCCTGAAGAGGCAATCTGG + Intergenic
995052234 5:107719678-107719700 TCTAGCCTAAAGAGGCTGTCTGG - Intergenic
995136547 5:108685806-108685828 CCCTGTCTAGAGAGTCAGTCTGG + Intergenic
995264157 5:110138833-110138855 TCTGGCCTAAAGAGGCAGTTTGG + Intergenic
995428496 5:112049626-112049648 ACCTGCTTAAAGCAGCAGTCTGG - Intergenic
995594207 5:113730987-113731009 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
995666188 5:114544901-114544923 TCAGGCCTGTAGAGGCAGTCTGG - Intergenic
995960146 5:117829671-117829693 TCAGGCCTGTAGAGGCAGTCTGG + Intergenic
996036332 5:118762742-118762764 ATCTGCTTAAAGAAGCAGTCTGG - Intergenic
996054657 5:118969330-118969352 ACCTGCTTAAAGAAGCAGTCTGG - Intronic
996425896 5:123313231-123313253 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
996482219 5:123988353-123988375 TCCTACTTAAAGAAGCAGTCTGG + Intergenic
996639073 5:125730652-125730674 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
996675702 5:126172301-126172323 TCAGGCCTAAAGAGGCACTCTGG - Intergenic
996778628 5:127159848-127159870 TCCTGCTTAAAGAAGTAGTCAGG + Intergenic
996778736 5:127160475-127160497 TCCTGCTTCAAGAAGCAGTCTGG + Intergenic
996829657 5:127726656-127726678 TCCAGCCTCAAGAGGCAATCTGG - Intergenic
997205171 5:132043902-132043924 ACCTGCTTAAAGAAGCAGCCTGG + Intergenic
997757819 5:136416439-136416461 TTCTGCCTACAGAGGTAGTAAGG + Intergenic
998205933 5:140156983-140157005 TGCAGGCTAGAGAGGCAGTCAGG + Intergenic
998760205 5:145424215-145424237 TGCAGCCTACAGAGGCAGGCAGG + Intergenic
998788831 5:145744064-145744086 TCAGGCCTGAAGAGGCACTCTGG - Intronic
998797909 5:145838337-145838359 TCCTGCTTAAAGATACACTCTGG - Intergenic
999666193 5:153916366-153916388 ACCCGCTTAAAGAAGCAGTCTGG + Intergenic
999938576 5:156515910-156515932 TCCCACCTAAAGAAGCAGTCTGG - Intronic
1000031541 5:157406286-157406308 ACCTGCTTAAAGCAGCAGTCAGG - Intronic
1000112655 5:158123749-158123771 TTCTGCATAAAGGGGAAGTCAGG - Intergenic
1000847843 5:166303884-166303906 TCAGACCTAAAGAGGGAGTCAGG - Intergenic
1001488022 5:172133730-172133752 TTCTGCCTAAAAAGTCAGTAGGG - Intronic
1001739125 5:174035339-174035361 TCCAGCCTAAGGAGGCAGTCTGG + Intergenic
1001763376 5:174225456-174225478 GCCTCCCTACAGAGGCAGGCAGG + Intronic
1001842508 5:174890992-174891014 CTCTGCTTAAAGAAGCAGTCTGG - Intergenic
1001843988 5:174904540-174904562 CTCTGCTTAAAGAAGCAGTCTGG - Intergenic
1002967175 6:1978227-1978249 TCCTGCCTAAAGTAGCAGTCTGG - Intronic
1002967232 6:1978491-1978513 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1003036822 6:2647379-2647401 TGCTGCCCAAAGAGGCAGGCTGG - Intergenic
1004983961 6:21059165-21059187 TCCCACCTAAAGAAGCAGTCTGG + Intronic
1006241123 6:32679854-32679876 TCCCACCTACAGAAGCAGTCTGG + Intergenic
1006712157 6:36083593-36083615 TTCAGCCTAAAGAGTCAGTCTGG - Intronic
1007827201 6:44609587-44609609 TTCTGCTTAAAGATGCAGTGGGG + Intergenic
1008082646 6:47210127-47210149 TCCCACATAAAGAAGCAGTCTGG - Intergenic
1009230823 6:61059449-61059471 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1009707123 6:67266315-67266337 TCTGGCCTAGAGAAGCAGTCTGG + Intergenic
1010812347 6:80314849-80314871 TCCTGCTTGAGGAAGCAGTCTGG + Intronic
1011297614 6:85840815-85840837 ATCTGCCTAAAGCAGCAGTCTGG - Intergenic
1011304539 6:85911458-85911480 TCCCACCTACAGAAGCAGTCTGG - Intergenic
1011370771 6:86634344-86634366 ACCTGCTTAAAGAAGCAGCCTGG + Intergenic
1011377647 6:86706877-86706899 TCCCACCTAAAGAAGCAGTCTGG + Intergenic
1011392222 6:86867155-86867177 ACCTGCTTAAGGAAGCAGTCTGG - Intergenic
1011916078 6:92508551-92508573 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1012075043 6:94672633-94672655 TCCCACCTAAAGAAGCAGTCTGG - Intergenic
1012075087 6:94672876-94672898 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1012093670 6:94931830-94931852 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1012142639 6:95642935-95642957 TCCTGCTTTAAAAGGCAGTCTGG - Intergenic
1012315055 6:97775198-97775220 TCCAGCCTAAAGAGGTAGTCTGG - Intergenic
1012572147 6:100742622-100742644 TCCTGCTTAAAGAAGCAGTCTGG + Intronic
1012869470 6:104656708-104656730 ACCTGCCCAAAGAAGCAGTCTGG - Intergenic
1012878077 6:104753391-104753413 ACTTGCCTAAAGAAGCAGTCTGG - Intronic
1013931975 6:115545368-115545390 TCCAGCCTAATGAGGTAGTCTGG - Intergenic
1014393524 6:120894781-120894803 ACCTACTTAAAGAAGCAGTCTGG + Intergenic
1014564321 6:122930039-122930061 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1014564384 6:122930324-122930346 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1014605824 6:123472594-123472616 TGGAGCCTACAGAGGCAGTCAGG - Intronic
1015358196 6:132305255-132305277 TCAAGCCTGAAGAGGCATTCTGG - Intronic
1015471897 6:133615045-133615067 CCCTGCTCAGAGAGGCAGTCTGG - Intergenic
1015587358 6:134789639-134789661 TCCCACCTAAAGAAGCAGTCTGG - Intergenic
1015901975 6:138076635-138076657 ACCTGCTTAAAGAAACAGTCTGG - Intergenic
1016423791 6:143912990-143913012 TCTTGCTTAAAGAAGCAGTCTGG + Intronic
1016847959 6:148587666-148587688 TCCTGCCTAAAGAAGCAGTCTGG + Intergenic
1016855995 6:148671268-148671290 TCCTGCCTAGTGAGGTAGTCTGG + Intergenic
1017739573 6:157394951-157394973 TCCTGCTCAAAGAAGCATTCTGG - Intronic
1020536468 7:9404241-9404263 TGGTGCCTACAGAGGCAGGCAGG + Intergenic
1020598950 7:10248234-10248256 TCCCACCTGAAGAAGCAGTCTGG - Intergenic
1020702216 7:11498365-11498387 TCCTGTTTAAAGCAGCAGTCTGG - Intronic
1021612706 7:22473787-22473809 TCTAGCCTACAGAGGCACTCGGG - Intronic
1021776506 7:24059805-24059827 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
1021782284 7:24118016-24118038 CCCTGCCTAGAGAGGCAGTCTGG + Intergenic
1021916966 7:25443828-25443850 ACCTGCTTAAAGAAGCAGTATGG + Intergenic
1021917014 7:25444094-25444116 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1022144337 7:27522069-27522091 TCCTGCCCAAAATGCCAGTCAGG - Intergenic
1022786722 7:33645448-33645470 TACTGCCTATAGAGGAAATCTGG + Intergenic
1022999487 7:35793354-35793376 TCCGGCCTCCCGAGGCAGTCTGG + Intergenic
1023196142 7:37641775-37641797 ATCTGCTTAAAGAGGCAGTATGG + Intergenic
1023666398 7:42527369-42527391 GCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1023666485 7:42527894-42527916 ACCTGCTTAAATAAGCAGTCTGG - Intergenic
1024022250 7:45382980-45383002 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
1024034390 7:45495205-45495227 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1024056449 7:45662643-45662665 TCCTGCATAGAGAGGGAGCCAGG - Intronic
1024589973 7:50872737-50872759 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
1024859635 7:53823651-53823673 TCCAGACCAAAGAAGCAGTCTGG - Intergenic
1024990550 7:55231830-55231852 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1025041691 7:55651383-55651405 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1025756921 7:64352674-64352696 ACCTGCTTTAACAGGCAGTCTGG + Exonic
1026045354 7:66902798-66902820 CCGGGCCTAAAGAGGCCGTCAGG - Intergenic
1026378649 7:69776920-69776942 TGCTGACTAAAGATCCAGTCTGG + Intronic
1028522995 7:91752813-91752835 TCCAGCCTAAAAAGGCAGCCTGG - Intronic
1029313175 7:99686547-99686569 TGGAGCCTAAAGAGGCAGGCAGG - Intronic
1030391146 7:108930514-108930536 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1030696174 7:112588008-112588030 TCCCGCTTAAAGAAGCAGTCTGG - Intergenic
1030696289 7:112588544-112588566 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1030830173 7:114210637-114210659 ACCTGTTTAAAGAAGCAGTCTGG + Intronic
1030830215 7:114210894-114210916 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1031254275 7:119428224-119428246 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1031291948 7:119949316-119949338 TCCCGCTTAAAAAAGCAGTCTGG - Intergenic
1031627207 7:124004901-124004923 ACCTGCTTAAAGCAGCAGTCTGG + Intergenic
1031804592 7:126292739-126292761 TCAGGCCTAAAGAAGCACTCTGG - Intergenic
1032004831 7:128292539-128292561 TGGAGCCTACAGAGGCAGTCAGG - Intergenic
1032455894 7:132073084-132073106 TCCTGCTGGGAGAGGCAGTCAGG - Intergenic
1032776809 7:135122276-135122298 TCAGGCCTGAAGAGGCACTCTGG - Intronic
1033066197 7:138156833-138156855 GCCTGACTACACAGGCAGTCAGG - Intergenic
1033565060 7:142570193-142570215 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1033791518 7:144796869-144796891 TTTGGCCTGAAGAGGCAGTCTGG - Intronic
1033868245 7:145718476-145718498 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1033977232 7:147116818-147116840 CTCTGCTTAAAGAAGCAGTCTGG + Intronic
1033989406 7:147265397-147265419 TCTGTCCTAAAGAGGCAGTTGGG - Intronic
1035380121 7:158432702-158432724 TGCTGCCTGAAGACGCAGCCTGG + Intronic
1036050163 8:5187536-5187558 TGGTGCCTACAGAGGCAGGCAGG - Intergenic
1036606245 8:10308122-10308144 TCTTGCCTAAAGATCCAGCCTGG - Intronic
1036731353 8:11268328-11268350 TCATTTCTAAAGAGGCTGTCTGG - Intergenic
1038429515 8:27488952-27488974 TCCTTCCTAAAGGCTCAGTCTGG - Intergenic
1038917227 8:32037678-32037700 TTCTGCTTAAAGAAGCAGTCTGG + Intronic
1039265155 8:35816082-35816104 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1039637057 8:39179014-39179036 ACCCGCTTAAAGAAGCAGTCTGG + Intronic
1039820520 8:41130162-41130184 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1039820567 8:41130430-41130452 ACGTGCTTAAAGAAGCAGTCTGG - Intergenic
1040087684 8:43363643-43363665 GCCTGCTTACAGAAGCAGTCTGG - Intergenic
1040091996 8:43408351-43408373 TCCTGTTGAAAGAAGCAGTCTGG + Intergenic
1040382979 8:46891099-46891121 TCCTGCCTAAAGAGAGATTATGG - Intergenic
1040400645 8:47046048-47046070 TCCTGTTTAAAGAAGCAGTCTGG - Intergenic
1040841821 8:51792722-51792744 TCTGGCCTGAAGAGGCTGTCTGG - Intronic
1041474542 8:58249076-58249098 TCCTGCTTAAAGAAGCATCCCGG - Intergenic
1041615364 8:59899910-59899932 CCCTGCTTAAAGAAGCAATCTGG - Intergenic
1041743085 8:61177224-61177246 TCCGGCCTGAAGAGGCACTCTGG - Intronic
1041889989 8:62858343-62858365 ACCTGCTTAAAGAAGCAGTCTGG + Intronic
1041944348 8:63424634-63424656 CCCTGCCTAGAGAGGCAGTCTGG - Intergenic
1041972611 8:63760832-63760854 TCCTGCTTAAAGCAGCAGTCTGG + Intergenic
1041972712 8:63761379-63761401 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1042489584 8:69381836-69381858 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1042620046 8:70694506-70694528 ACCTGCTTAAAGCAGCAGTCTGG + Intronic
1042629963 8:70805646-70805668 TCACGCCTGAAGAGGCACTCTGG - Intergenic
1042759667 8:72257217-72257239 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1043092571 8:75924267-75924289 TCCTGCTTAAATATGCAGTCTGG - Intergenic
1043233327 8:77830306-77830328 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1043301894 8:78744339-78744361 ACCTGCTTAAAGAAGCAGTCTGG + Intronic
1043304985 8:78782937-78782959 TGCAGCCTAAAGAGGCAGTCTGG + Intronic
1044018302 8:87073798-87073820 ACCTTCCTAAAGAAGCAGTCTGG + Intronic
1044315778 8:90748886-90748908 TCTGGCCTGAAGAGGCAATCTGG - Intronic
1044447533 8:92296630-92296652 ACCTGCTTAAAGAACCAGTCTGG + Intergenic
1044451072 8:92336155-92336177 CCCTGCTTAAAGAGGCATTATGG + Intergenic
1044504984 8:93006744-93006766 TCCTGCCTAAAGAGGCAGTCTGG - Intronic
1044871327 8:96622764-96622786 TCCTGCCTCAAAAGGCAATTGGG - Intergenic
1044873390 8:96641932-96641954 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1044873433 8:96642187-96642209 TCCCGCTTACAGAAGCAGTCTGG + Intergenic
1045083188 8:98650876-98650898 TGCAGCCTACAGAGGCAGGCAGG - Intronic
1045595497 8:103650413-103650435 ATCTGCCTAAAGAAGCAATCAGG + Intronic
1045797729 8:106065519-106065541 CCCTGCCTAGAGAGGCAGTCTGG - Intergenic
1046196680 8:110873130-110873152 TCCTGTCTATAGAGACAGTTGGG - Intergenic
1046657707 8:116913118-116913140 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1046702713 8:117419021-117419043 TCCAGCCTAAAGAGGCAGTCTGG - Intergenic
1047747658 8:127856791-127856813 TCCTGGCTACACAGCCAGTCAGG + Intergenic
1048532176 8:135259626-135259648 TGGAGCCTAAAGAGGCAGGCAGG - Intergenic
1050240200 9:3626566-3626588 CCCTGCTTAAAGAAACAGTCTGG + Intergenic
1050393106 9:5167505-5167527 TCCCACCTAAAGAAGCAGTCTGG - Intronic
1050394276 9:5178416-5178438 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1050395236 9:5188449-5188471 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1050618303 9:7426319-7426341 TCAGGCCTAAAGAGGCTCTCTGG + Intergenic
1051459101 9:17293526-17293548 TTCCGCCTGAAGAGGCAGTCTGG + Intronic
1052225279 9:26077897-26077919 TTAGGCCTAAAGAGGCACTCTGG + Intergenic
1052311686 9:27075133-27075155 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1052515318 9:29472517-29472539 TCCTCCTTAAAGAGGCAGTCTGG + Intergenic
1052716964 9:32128888-32128910 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1053039350 9:34856769-34856791 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1053700067 9:40681285-40681307 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
1053928699 9:43093211-43093233 TTCCGCCTAAAAAAGCAGTCTGG - Intergenic
1054311359 9:63480683-63480705 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
1054410139 9:64804836-64804858 TGGAGCCTAAAGAGGCAGGCAGG + Intergenic
1055343337 9:75308725-75308747 TCCTATTTAAAGAAGCAGTCTGG + Intergenic
1055343562 9:75310633-75310655 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1055660941 9:78503351-78503373 TCCAGCTCAAAGAAGCAGTCTGG + Intergenic
1055818864 9:80238456-80238478 TGCAGCCTGAAGAGGCAATCTGG - Intergenic
1056002022 9:82227683-82227705 TCCTGCTTAAAGATGCAGTCTGG + Intergenic
1056378433 9:86036099-86036121 TCCTGCATAAAGGTGCAGCCTGG + Intronic
1056907583 9:90666587-90666609 ACCCACCTAAAGAAGCAGTCTGG + Intergenic
1057555824 9:96086882-96086904 TCCAGGTGAAAGAGGCAGTCCGG - Intergenic
1058200149 9:102028639-102028661 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1058514075 9:105751833-105751855 TCCTGCTTAAAGAAGCAGTCTGG - Intronic
1058530360 9:105900174-105900196 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1059004219 9:110383857-110383879 TCCAGCCTAAAGAGGCAGTCTGG + Intronic
1059023304 9:110598964-110598986 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1059023348 9:110599228-110599250 TCCTGCTTAATGAAGCAGTCTGG + Intergenic
1059076318 9:111197288-111197310 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1059076363 9:111197552-111197574 AACTGCTTAAAGAAGCAGTCTGG - Intergenic
1059262702 9:112993804-112993826 CCTGGCCTAAAGAGACAGTCTGG + Intergenic
1060321114 9:122562092-122562114 TCTTGCCTGAAGAGGCACTCTGG + Intergenic
1060738529 9:126082095-126082117 TCCTGCCAAAAGAGACAGGTGGG + Intergenic
1062491629 9:136807808-136807830 TTCTGCGTAAGGAGGCAGCCCGG + Intergenic
1062743102 9:138192528-138192550 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1062743351 9:138194529-138194551 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1062743600 9:138196530-138196552 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1203368508 Un_KI270442v1:279307-279329 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1185488471 X:500581-500603 TCCTGCGTACAGAGGCAGAGGGG - Intergenic
1186354230 X:8773388-8773410 CCCTGCCTAGAGAGGCGGTCGGG - Intergenic
1186741013 X:12517959-12517981 TCTGGCCTAAAGAGGCAGTCTGG + Intronic
1186964429 X:14772358-14772380 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1187089690 X:16082639-16082661 TCATTCCTACAGTGGCAGTCTGG + Intergenic
1187646146 X:21348996-21349018 TCGTGCTTAAAGAAGCAGTCTGG - Intergenic
1187729557 X:22238701-22238723 CTCTGCCTAGAGAGGCAGTCTGG - Intronic
1187818209 X:23256239-23256261 GCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1188099872 X:26071021-26071043 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1188669772 X:32868640-32868662 TCCGGCCTAATGAGGCAATCTGG - Intronic
1188723483 X:33551682-33551704 GCCCGCTTAAAGAAGCAGTCTGG + Intergenic
1188901083 X:35733766-35733788 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1189571884 X:42306854-42306876 TCAAGCCTGAAGAGGCACTCTGG - Intergenic
1189581703 X:42413850-42413872 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1189581761 X:42414120-42414142 CCCTGCTTAGAGAAGCAGTCTGG + Intergenic
1189861422 X:45276225-45276247 TCTCGCTTAAAGAAGCAGTCTGG + Intergenic
1189940146 X:46112893-46112915 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1190803493 X:53813791-53813813 CCCTGCTTAAAGAGGAAGCCTGG + Intergenic
1190960400 X:55241062-55241084 TCTCGCTTAAAGAAGCAGTCTGG - Intronic
1190971796 X:55356883-55356905 TCCTGCTTAAAGAAGCGGTCTGG - Intergenic
1190977201 X:55417105-55417127 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1191022622 X:55878684-55878706 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1191034382 X:56008829-56008851 TCTGGCCTAAAGAGGCAGTCTGG - Intergenic
1191065486 X:56343108-56343130 ACCCGCTTAAAGAAGCAGTCTGG + Intergenic
1191093898 X:56654801-56654823 TCCTGCTTAAGGAAGCAGTCTGG + Intergenic
1191225189 X:58035103-58035125 TCTGGCCTAAAGAGGTGGTCTGG + Intergenic
1191832367 X:65429505-65429527 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1191876931 X:65807005-65807027 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1191889459 X:65925643-65925665 TCTTGCTTAAAGAAGCAGTCTGG + Intergenic
1192011398 X:67277398-67277420 ACTTGCTTAAAGAAGCAGTCTGG - Intergenic
1192292780 X:69815297-69815319 TCCTGCTTAAAGAAGCAGTTTGG - Intronic
1192292884 X:69815836-69815858 ACCTGCCCTAAGAAGCAGTCTGG - Intronic
1192718618 X:73669073-73669095 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1192718664 X:73669338-73669360 CCCTGCTTAAAGAAGCAGTCTGG + Intronic
1192718722 X:73669624-73669646 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1192897502 X:75459552-75459574 TCCTGCTTATAGAAGCAGCCTGG - Intronic
1192897597 X:75460173-75460195 TCCCACTTAAAGAAGCAGTCTGG - Intronic
1192930249 X:75799240-75799262 TCAGGCCTGAAGAGGCACTCTGG + Intergenic
1193164273 X:78263844-78263866 TCCTGCTTAATGAAGCACTCTGG + Intergenic
1193164332 X:78264104-78264126 TCCAGCCTAAAGAGGCAGTTTGG + Intergenic
1193176475 X:78400681-78400703 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1193176526 X:78400946-78400968 ACCCGCTTAAAGAAGCAGTCTGG - Intergenic
1193216955 X:78875261-78875283 TCCCACCTAAAGAAGCAGTCTGG - Intergenic
1193274523 X:79570330-79570352 TCCTGCTTAAAGAAGCAGTATGG + Intergenic
1193274576 X:79570653-79570675 TCCAGCTTAAAGCAGCAGTCTGG + Intergenic
1193301380 X:79892431-79892453 GCCTGCTTATAGAAGCAGTCTGG - Intergenic
1193365163 X:80623165-80623187 TCTGGCCTAAAGAGGCAGTCTGG + Intergenic
1193528106 X:82618774-82618796 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic
1193528146 X:82619040-82619062 ACCTGCCCAAAGAATCAGTCTGG - Intergenic
1193533638 X:82686577-82686599 TCTGTCCTAAAGAGGCAGTCTGG + Intergenic
1193595424 X:83439301-83439323 GCCAGCCTAAAGAGGCAGTCTGG + Intergenic
1193625750 X:83818752-83818774 ACCTGCTTAAATAAGCAGTCTGG + Intergenic
1193625842 X:83819329-83819351 TCCTGCTTAAAGAAGTACTCTGG + Intergenic
1193687177 X:84591839-84591861 TCCCACCTAAGGAAGCAGTCTGG - Intergenic
1193712160 X:84893575-84893597 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1193739813 X:85203623-85203645 ACCTGCTTAAAGCAGCAGTCTGG + Intergenic
1193762811 X:85488725-85488747 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1193844774 X:86455268-86455290 ACCTGCTTAAGGAAGCAGTCTGG + Intronic
1193909163 X:87280781-87280803 TCCCACCTAAAGAAGCAGTCTGG + Intergenic
1193951909 X:87809837-87809859 TCACGCCTAAAGAGCCAGTCTGG + Intergenic
1193985705 X:88238091-88238113 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1194177222 X:90665441-90665463 TCTGACCTAAAGAGGCAGTCTGG - Intergenic
1194193513 X:90865352-90865374 TCTGTCCTAAAGAGGCAGTCTGG - Intergenic
1194263943 X:91733293-91733315 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1194281365 X:91958020-91958042 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1194405755 X:93494109-93494131 ACCTGCTTAAATAAGCAGTCTGG - Intergenic
1194444956 X:93975918-93975940 TCCTGCTTAAAGAAGCAGTCTGG + Intergenic
1194494446 X:94594486-94594508 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1194506358 X:94738678-94738700 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1194506400 X:94738946-94738968 TCCTGCTTAAGGAAGCAGTCTGG + Intergenic
1194537237 X:95119925-95119947 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1194580662 X:95666485-95666507 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1194635606 X:96342454-96342476 ACCTGCTTAAAAAAGCAGTCTGG + Intergenic
1194953454 X:100153320-100153342 TCCCACCTAAAGAAGCAGTCTGG + Intergenic
1194953510 X:100153588-100153610 TCCCACTTAAAGAAGCAGTCTGG + Intergenic
1195153419 X:102097451-102097473 TTCAGCCTGAAGAGGCAGTCTGG - Intergenic
1195213097 X:102669551-102669573 TGCCACCTAAAGAAGCAGTCTGG + Intergenic
1195812670 X:108851575-108851597 TCCGGCCTAAAGAGGCAGTCTGG - Intergenic
1195958400 X:110359361-110359383 TAATGCCAAAAGAGGCAGTGTGG - Intronic
1196054480 X:111340263-111340285 TCAGGCCTGAAGAGGCACTCTGG - Intronic
1196284511 X:113863829-113863851 TCCACCCTAAAGAGGCAGTCTGG + Intergenic
1196932499 X:120695783-120695805 ACCTGCTTAAAGCAGCAGTCTGG - Intergenic
1197023148 X:121715945-121715967 ACCTGCCCAAAGAAGCAGGCTGG + Intergenic
1197023190 X:121716209-121716231 TTTTGCTTAAAGAAGCAGTCTGG + Intergenic
1197114719 X:122818500-122818522 TCCGGCTTAAAGAAGCGGTCTGG - Intergenic
1197122131 X:122905837-122905859 ACCTGCTTAAAAAGGCAGTCTGG - Intergenic
1197413828 X:126150666-126150688 TCCCGCTTAAAGAAGCAGTCTGG + Intergenic
1197428088 X:126323319-126323341 TCCCGCTTAAAGAAGCAGTCTGG - Intergenic
1197428137 X:126323588-126323610 TCCTGCTTAAATAAGCAGTCTGG - Intergenic
1197522667 X:127519608-127519630 TTCCACCTAAAGAAGCAGTCTGG - Intergenic
1197684895 X:129428303-129428325 ACCTTCCTAAAAAGACAGTCTGG - Intergenic
1198149844 X:133897534-133897556 TTCTGCCTATAGCAGCAGTCAGG + Intronic
1198687083 X:139238214-139238236 TCTTGCTTAAAGAAGCAGTCTGG - Intergenic
1198841352 X:140861092-140861114 TCTGGCCCAAAGAGGCAGTCTGG - Intergenic
1199308229 X:146292635-146292657 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
1199310843 X:146317957-146317979 TCTGGCCTAAAAAGGCAGTCTGG - Intergenic
1199461966 X:148094528-148094550 TCCTTCCTCAAGAGCCATTCAGG + Intergenic
1199589222 X:149451002-149451024 ATCTGCTTAAAGAAGCAGTCTGG + Intergenic
1199589283 X:149451262-149451284 TCCCGCTTAAAGAAGCAGTCTGG + Intergenic
1200232139 X:154449417-154449439 TCCTCCCAAAAGAGGGGGTCAGG + Intronic
1200321760 X:155196833-155196855 TCCAGCCTAAAGAGGCAGTCTGG + Intergenic
1200336263 X:155354122-155354144 ACCTGCTTAAAGAAGCAGTCTGG - Intergenic
1200344625 X:155435957-155435979 TCCCACTTAAAGAAGCAGTCTGG - Intergenic
1200350207 X:155487105-155487127 ACCTGCTTAAAGAAGCAGTCTGG + Intergenic
1200540124 Y:4447739-4447761 TCTGTCCTAAAGAGGCAGTCTGG - Intergenic
1200598954 Y:5182676-5182698 TCCCACTTAAAGAAGCAGTCTGG + Intronic
1200847712 Y:7849253-7849275 ACCTGCTTTAACAGGCAGTCTGG - Intergenic
1200899670 Y:8416812-8416834 TCCTGCTTTAATAGGCAGTCTGG - Intergenic
1200904772 Y:8470694-8470716 TCCTGCCTACAGAGGCAGTTTGG + Intergenic
1201070188 Y:10140995-10141017 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1201410236 Y:13691862-13691884 TGGAGCCTACAGAGGCAGTCAGG - Intergenic
1201756740 Y:17494412-17494434 GACTGCTTAAAGAAGCAGTCTGG - Intergenic
1201844813 Y:18411572-18411594 GACTGCTTAAAGAAGCAGTCTGG + Intergenic
1201935979 Y:19411424-19411446 TCCTGTTTAATGAAGCAGTCTGG - Intergenic
1202092532 Y:21208919-21208941 TCAGGCCTGAAGAGGCACTCTGG - Intergenic
1202269346 Y:23055260-23055282 ACCTGCTTTAACAGGCAGTCTGG + Intergenic
1202422340 Y:24689006-24689028 ACCTGCTTTAACAGGCAGTCTGG + Intergenic
1202448449 Y:24981080-24981102 ACCTGCTTTAACAGGCAGTCTGG - Intergenic
1202596752 Y:26548392-26548414 TCCTGCTTAAAGAAGCAGTCTGG - Intergenic