ID: 1044504985

View in Genome Browser
Species Human (GRCh38)
Location 8:93006752-93006774
Sequence AGTCTAAGTCCTGCCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044504985_1044504987 -2 Left 1044504985 8:93006752-93006774 CCTCTTTAGGCAGGACTTAGACT 0: 1
1: 0
2: 3
3: 26
4: 165
Right 1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG No data
1044504985_1044504986 -3 Left 1044504985 8:93006752-93006774 CCTCTTTAGGCAGGACTTAGACT 0: 1
1: 0
2: 3
3: 26
4: 165
Right 1044504986 8:93006772-93006794 ACTCCTCCCTCTTCACTGTGTGG No data
1044504985_1044504988 -1 Left 1044504985 8:93006752-93006774 CCTCTTTAGGCAGGACTTAGACT 0: 1
1: 0
2: 3
3: 26
4: 165
Right 1044504988 8:93006774-93006796 TCCTCCCTCTTCACTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044504985 Original CRISPR AGTCTAAGTCCTGCCTAAAG AGG (reversed) Intronic
900265746 1:1756198-1756220 AGTCTAGGTGCTGCGTAACGAGG - Intronic
909552972 1:76919660-76919682 AGTCTAAGTGCTGAGTAAATGGG + Intronic
911315846 1:96355819-96355841 ATTCTAAGCCCTGACTGAAGTGG + Intergenic
913015998 1:114735865-114735887 GGTCTATTTCCTGCCTATAGGGG - Intronic
913691066 1:121280478-121280500 GGTCTAAGCTCTGTCTAAAGAGG - Intronic
914146473 1:144999484-144999506 GGTCTAAGCTCTGTCTAAAGAGG + Intronic
915719442 1:157973591-157973613 GGGCTAAGGCCTGCCTGAAGTGG - Intergenic
917879765 1:179322873-179322895 AGTCTAGGGCCTGCCCAAAATGG - Intronic
919629517 1:199946433-199946455 ATTTTAAGTTCAGCCTAAAGAGG + Intergenic
920478390 1:206298954-206298976 GGTCTAAGCCCTGTCTAAAGAGG - Intronic
920678295 1:208054056-208054078 AGTCTAATTCTAGCCTAATGAGG - Intronic
921309397 1:213827755-213827777 AGTCTAAGCCCTGCTAGAAGTGG - Intergenic
922089980 1:222386854-222386876 AGTTTAAGTCCAGCAAAAAGGGG - Intergenic
922867350 1:228871575-228871597 AGGCTAATTCCGGTCTAAAGGGG - Intergenic
1069301474 10:66913640-66913662 AGTCTAAGTGCTTACTGAAGGGG + Intronic
1069806855 10:71131684-71131706 AGTCCAAGTCCAGCCCAGAGAGG - Intergenic
1069832659 10:71290773-71290795 AGTCTGAGCCCTGCCTACACAGG - Intronic
1072141829 10:92595788-92595810 ACTCTAAGTACTTCATAAAGTGG + Intronic
1074611651 10:115027653-115027675 AGACTCAGTCCTGCCTTAGGAGG + Intergenic
1075237949 10:120748599-120748621 AGTTTAAGTCCAGACTAGAGGGG + Intergenic
1076954338 10:133687421-133687443 TGTCTAAGCTGTGCCTAAAGGGG - Intergenic
1076954440 10:133688311-133688333 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1076954618 10:133689876-133689898 AGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1076961246 10:133763610-133763632 TGTCTAAGCTGTGCCTAAAGGGG - Intergenic
1081411408 11:42762676-42762698 GGTTTCAGTCCTGCCTAAGGAGG - Intergenic
1084703651 11:70803464-70803486 AGACAAAGTCCTGCCTGCAGAGG + Intronic
1091586968 12:1822088-1822110 AGTCTCAGCACTGCCAAAAGAGG + Intronic
1094256763 12:28439084-28439106 AGTCAAAGTCCTACTTAAATAGG + Intronic
1097656833 12:62375277-62375299 AGTCCAAATGATGCCTAAAGAGG - Intronic
1097902591 12:64888328-64888350 AGTTTAAATCTTGTCTAAAGAGG + Intergenic
1105464980 13:20631518-20631540 AGTCTAAAAGCTCCCTAAAGGGG + Intronic
1106631734 13:31481140-31481162 TGTCTAAGTCTTCTCTAAAGAGG - Intergenic
1112569191 13:100578596-100578618 AGTCTAAGTCATGGTTAACGTGG - Intronic
1116358887 14:43967832-43967854 AATGTAAGCCCTGCCTTAAGAGG + Intergenic
1119807110 14:77489375-77489397 GGTCTCAGGCCTGGCTAAAGAGG - Intronic
1120805652 14:88746745-88746767 AGTCTAGGGCCTACCTAAGGTGG + Intronic
1121411521 14:93751630-93751652 AGCCTAAGTCCTGTTTAAAAGGG + Intronic
1121706794 14:96002357-96002379 AGTCAGGGTCCAGCCTAAAGAGG - Intergenic
1122745587 14:103895516-103895538 AGTCTAAGACCAGCCTCACGCGG + Intergenic
1202849005 14_GL000225v1_random:4401-4423 TGTCTAGGTTCTGCCTAAAGGGG - Intergenic
1202849286 14_GL000225v1_random:6921-6943 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1202850609 14_GL000225v1_random:15612-15634 TGTCTAAGCTCTGCCTACAGAGG - Intergenic
1202851032 14_GL000225v1_random:19641-19663 TGTCTAAGCTCTGCCTAAATGGG - Intergenic
1202851275 14_GL000225v1_random:21890-21912 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1202851963 14_GL000225v1_random:26633-26655 TGTCTAAGCTCTGCCTACAGTGG + Intergenic
1202852058 14_GL000225v1_random:27591-27613 TGTCTAGGCTCTGCCTAAAGGGG + Intergenic
1202852156 14_GL000225v1_random:28441-28463 TGTCTAGGCTCTGCCTAAAGGGG + Intergenic
1202852233 14_GL000225v1_random:29053-29075 GGTCTAAGCTCTGGCTAAAGGGG + Intergenic
1202853226 14_GL000225v1_random:34891-34913 GGTCTAAGCTCTGCCTAACGGGG - Intergenic
1202854256 14_GL000225v1_random:40650-40672 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1202855799 14_GL000225v1_random:51425-51447 GGTCTAAGCTCTGCCTTAAGGGG - Intergenic
1202856750 14_GL000225v1_random:56632-56654 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1202857797 14_GL000225v1_random:62403-62425 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1202858636 14_GL000225v1_random:66389-66411 GGTCTCAGCGCTGCCTAAAGGGG + Intergenic
1202859104 14_GL000225v1_random:70693-70715 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1202861779 14_GL000225v1_random:87982-88004 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1202862599 14_GL000225v1_random:91963-91985 GGTCTAAGCTCTGCCTTAAGGGG + Intergenic
1202862866 14_GL000225v1_random:94418-94440 GGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1202863107 14_GL000225v1_random:96737-96759 TGTCTAAGCTCTGCCTAAGGGGG + Intergenic
1202863701 14_GL000225v1_random:101614-101636 TGTCTAAGCTCTGCCTAAAAGGG + Intergenic
1202864462 14_GL000225v1_random:106034-106056 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1202864757 14_GL000225v1_random:108761-108783 GGTCTAAGCTCTGCCTAAAAGGG - Intergenic
1202865053 14_GL000225v1_random:111553-111575 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1202865794 14_GL000225v1_random:115961-115983 TGTATAAGTTCTGCCTACAGGGG + Intergenic
1202865802 14_GL000225v1_random:116029-116051 AGTCTAGGCTTTGCCTAAAGGGG + Intergenic
1202866584 14_GL000225v1_random:123338-123360 TGTCTAGGCTCTGCCTAAAGGGG + Intergenic
1202867265 14_GL000225v1_random:129642-129664 TGTCTAAGTTCTGCTTAAAGGGG + Intergenic
1202868741 14_GL000225v1_random:139862-139884 TGTCTAGGATCTGCCTAAAGGGG + Intergenic
1124196932 15:27639551-27639573 GGTCAGGGTCCTGCCTAAAGAGG - Intergenic
1124366099 15:29072556-29072578 AGTCTCAGCCCTGCAGAAAGGGG + Intronic
1130937075 15:88479647-88479669 AGTCTAATTCCTTCCGACAGTGG - Exonic
1131107471 15:89744829-89744851 AGTGGAAGGCCTGCCTGAAGGGG - Intergenic
1135637945 16:24095035-24095057 AATCCATGTCCTGTCTAAAGGGG - Intronic
1141517089 16:84552681-84552703 AATCTATGTCCTGCTTAAATAGG - Intronic
1144257818 17:13486970-13486992 AGTCTAAAACCTGGCTATAGAGG + Intergenic
1144291331 17:13829469-13829491 AGTATAAGTCTTGCCTGACGTGG - Intergenic
1152965175 18:107900-107922 GGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1164169723 19:22714697-22714719 AGGCTAAGCCCTGCCCACAGAGG - Intergenic
1164260571 19:23565501-23565523 TGCCTAGGTCCTGCCTACAGAGG - Intronic
1165618193 19:37220736-37220758 AGGATAAGTGTTGCCTAAAGAGG - Intronic
1166627650 19:44373953-44373975 AGTCTAGGACCTGCCAAAGGTGG + Intronic
1168075467 19:53978844-53978866 AGACGAAGTCAGGCCTAAAGGGG + Intronic
1168197257 19:54784160-54784182 TGTCTAAGTGCTGCGTTAAGAGG - Exonic
925245582 2:2379666-2379688 AGTCCCAGTCATGGCTAAAGGGG + Intergenic
925460515 2:4058969-4058991 AGACTAGGTCCTTCCTCAAGGGG + Intergenic
934014386 2:87863446-87863468 AATCATAGTCCTGCCTAAATTGG - Intergenic
935952649 2:108345113-108345135 GGTCCAGGTCCAGCCTAAAGAGG + Intergenic
939538986 2:143469650-143469672 TGTGTAAGTCATACCTAAAGTGG - Intronic
939702711 2:145413535-145413557 AGACTAGGTCCTTCCTGAAGAGG - Intergenic
940255570 2:151724642-151724664 AGTCCATGCCCTGCCCAAAGAGG - Intronic
941920004 2:170840767-170840789 GGACTAAGTTCTGGCTAAAGAGG - Intronic
942017558 2:171832141-171832163 AGTCTAAGTACTGCCAAGATAGG + Intronic
946549793 2:220788837-220788859 ACTGTAAGTCCTGCTTCAAGAGG - Intergenic
1171964048 20:31515878-31515900 AGTGGAAGTCTTGCCCAAAGAGG + Intronic
1172026190 20:31950490-31950512 ATTCAACGTCCTGCCTAAAATGG + Intronic
1172662429 20:36576317-36576339 AGTCTAGGACCAGGCTAAAGGGG + Intronic
1175591939 20:60200343-60200365 GGTCTGAGTTCAGCCTAAAGAGG + Intergenic
1180413891 22:12692163-12692185 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1181772564 22:25136787-25136809 GGTCTAAGTTCTGCCTTGAGAGG - Intronic
954939713 3:54360496-54360518 AGCCTGAGTCCTGCCACAAGAGG - Intronic
956573178 3:70719795-70719817 AGTCAAAGTCCTGCTTACAGTGG + Intergenic
960486154 3:118255077-118255099 GGTTCATGTCCTGCCTAAAGGGG + Intergenic
967881556 3:194305433-194305455 AGGCAAAGTCCTGCCTGAAATGG + Intergenic
967929373 3:194679655-194679677 AGTCCACTTCCTTCCTAAAGAGG + Intergenic
974409675 4:61523476-61523498 ACTCTAAGTCTTGTCTAAAATGG - Intronic
977086155 4:92601127-92601149 AGTCAGGGTCCAGCCTAAAGAGG + Intronic
977318162 4:95477480-95477502 ATTCTAAGCACTGTCTAAAGGGG + Intronic
977599453 4:98920162-98920184 AGGCTAAGTTCTGTCTAATGTGG - Intronic
978225759 4:106333078-106333100 AGTCTAACTTCCACCTAAAGGGG - Intronic
978574519 4:110175785-110175807 AGTCTAAGTCATGCCTTCATAGG + Intronic
979956790 4:126963191-126963213 AGTCAAAGTTCTGCCTAGAAAGG - Intergenic
982663114 4:158229495-158229517 AGTCAAAGTGCTGCCTTAAATGG - Intronic
984586680 4:181572267-181572289 ATTCTCAGTCCTTCCTACAGGGG + Intergenic
985298085 4:188456971-188456993 AGTTTAAGTCATGCCAAAAAGGG + Intergenic
985463884 4:190176302-190176324 TGTCTAAGCTCTGCCTACAGGGG - Intronic
985464023 4:190177533-190177555 TGTCTAAGCTGTGCCTAAAGGGG - Intronic
985464127 4:190178423-190178445 TGTCTAAGCTCTGCCTACAGGGG - Intronic
985464304 4:190179988-190180010 AGTTTAAGCTCTGCCTAAAGGGG - Intronic
985464407 4:190181154-190181176 AGTCTAAGCTCTGCCTAAAGGGG - Intronic
986011902 5:3724473-3724495 GGTCAAAGTCCAGCCTAAAGAGG + Intergenic
987096540 5:14555680-14555702 AGTCTAAGTGCTTCCCAAACTGG - Intergenic
987243147 5:16021660-16021682 AGGCTAAGCCATGCCTAAAGTGG + Intergenic
987374891 5:17224885-17224907 AAACCAAGTCCTGCCTAAATTGG + Intronic
989909098 5:49600942-49600964 TGTCTAAGCTGTGCCTAAAGGGG - Intergenic
990529889 5:56662855-56662877 TCTCTAAATCCTGCCCAAAGAGG + Intergenic
992619499 5:78578545-78578567 AGCCTAAGCCCTTCCTAAACAGG - Intronic
993080937 5:83300221-83300243 AGCCTAGGGCCTGTCTAAAGTGG - Intronic
993643463 5:90434311-90434333 AGCGTAAGTCCCACCTAAAGGGG - Intergenic
997009358 5:129858609-129858631 ACTCTCAGTCCTGCCTAAAGAGG - Intergenic
997309584 5:132868662-132868684 AGGCTAAGGCCTGCCTTAGGAGG - Intergenic
1000925957 5:167194374-167194396 AGTGGAAATCTTGCCTAAAGTGG - Intergenic
1001239838 5:170060126-170060148 AGTATAAGTTCTGCCTATTGGGG + Intronic
1007569833 6:42881598-42881620 AGTCTCACTCTTGCCTAGAGTGG + Intronic
1007876592 6:45110074-45110096 AGTCACAGTCCTTCCTAAAATGG - Intronic
1012315056 6:97775206-97775228 GGTCAGAGTCCAGCCTAAAGAGG - Intergenic
1024589974 7:50872745-50872767 GGTCACAGTCCAGCCTAAAGAGG - Intergenic
1028069176 7:86429344-86429366 AGTGTAAATCCTGAGTAAAGAGG - Intergenic
1038112434 8:24514167-24514189 CTTCAAAGTCATGCCTAAAGTGG + Intronic
1039119816 8:34133028-34133050 ACTCAAAGTCCTACCAAAAGAGG - Intergenic
1039377491 8:37050625-37050647 AGACTAAGTCCCTCCTAATGTGG + Intergenic
1040375916 8:46824455-46824477 TGCCTAAGTCCTGCATAAAGAGG + Intergenic
1043593481 8:81856933-81856955 TGTTTAAGTCCTCCCTGAAGAGG - Intergenic
1044288370 8:90437717-90437739 TGTCTAAGTCCTTACTACAGAGG - Intergenic
1044504985 8:93006752-93006774 AGTCTAAGTCCTGCCTAAAGAGG - Intronic
1053476807 9:38388000-38388022 AATGAAAGCCCTGCCTAAAGGGG + Intergenic
1053502742 9:38614350-38614372 AGTTTAAGTCCAGCCTGAGGCGG - Intergenic
1059004218 9:110383849-110383871 AGTCAGGGTCCAGCCTAAAGAGG + Intronic
1203736034 Un_GL000216v2:140391-140413 TGTCTAGGATCTGCCTAAAGGGG - Intergenic
1203737757 Un_GL000216v2:152956-152978 TGTCTAGGCTCTGCCTAAAGGGG - Intergenic
1203738533 Un_GL000216v2:160129-160151 AGTCTAGGGTTTGCCTAAAGGGG - Intergenic
1203739275 Un_GL000216v2:164472-164494 GGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1203739592 Un_GL000216v2:167461-167483 GGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1203739864 Un_GL000216v2:169983-170005 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1203740944 Un_GL000216v2:176472-176494 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1187370000 X:18697283-18697305 AGATTAAGTCCAGCCTGAAGAGG + Intronic
1194930405 X:99880903-99880925 AGTCAAGGTCCAGCCTAAAGAGG - Intergenic
1195812671 X:108851583-108851605 AGTCAGGGTCCGGCCTAAAGAGG - Intergenic
1198746381 X:139895208-139895230 AATCTAAGTTCTGCCTAATGAGG - Intronic
1199130088 X:144175027-144175049 AATCATAGTCCTGCCTAAATTGG + Intergenic
1199471624 X:148202000-148202022 AGTCTAGGTCCTGTTTAATGAGG + Intergenic
1200866451 Y:8048694-8048716 TTACTAGGTCCTGCCTAAAGAGG + Intergenic
1200892172 Y:8335715-8335737 TGCCTAAGCCCTGCCTACAGGGG + Intergenic
1200900691 Y:8428960-8428982 ATCCTAGGTCCTGCCTAAAGAGG - Intergenic
1201125584 Y:10911037-10911059 TGTCTAGGTTCTGCTTAAAGAGG - Intergenic
1201125718 Y:10912335-10912357 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1201125933 Y:10914193-10914215 TGTCTAGGCTCTGCCTAAAGGGG + Intergenic
1201125971 Y:10914576-10914598 GGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1201126079 Y:10915596-10915618 TGTCTAGGTTCTGCCTACAGGGG + Intergenic
1201126364 Y:10918393-10918415 GGTCTAAGCTCTGCCTAAAGAGG + Intergenic
1201126504 Y:10919834-10919856 TGTCTAAGCTCTGCCTAAAGGGG + Intergenic
1201175223 Y:11304566-11304588 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1201175348 Y:11305654-11305676 TGTCTAGGCTCTGCCTAAAGTGG - Intergenic
1201176151 Y:11309357-11309379 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1201176185 Y:11309630-11309652 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1201176446 Y:11312094-11312116 TGTCTAGGTTCTGCCTACAGTGG - Intergenic
1201176542 Y:11312976-11312998 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1201176593 Y:11313452-11313474 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1201177409 Y:11317435-11317457 TGTCTAAGCTCTGCCTACAGGGG - Intergenic
1201177541 Y:11318598-11318620 TGTCTAAGTTGCGCCTAAAGGGG - Intergenic
1201177714 Y:11320099-11320121 GGTCTAAGCTCTGCCTAAAGGGG - Intergenic
1201179177 Y:11330078-11330100 TGTCTAGGTTCTGCTTAAAGGGG - Intergenic
1201179184 Y:11330146-11330168 GATCTAAGCTCTGCCTAAAGGGG - Intergenic
1202245771 Y:22818602-22818624 ATTCTATATCCTGCCTAGAGAGG + Intergenic
1202270860 Y:23072854-23072876 TGCCTGAGTCCTGCCTAATGGGG + Intergenic
1202295166 Y:23347828-23347850 TGCCTGAGTCCTGCCTAATGGGG - Intergenic
1202398759 Y:24452350-24452372 ATTCTATATCCTGCCTAGAGAGG + Intergenic
1202423855 Y:24706598-24706620 TGCCTGAGTCCTGCCTAATGGGG + Intergenic
1202446934 Y:24963487-24963509 TGCCTGAGTCCTGCCTAATGGGG - Intergenic
1202472021 Y:25217736-25217758 ATTCTATATCCTGCCTAGAGAGG - Intergenic
1202624030 Y:56839253-56839275 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1202624105 Y:56840005-56840027 TGTCTAGGCTCTGCCTAAAGGGG + Intergenic
1202624319 Y:56841916-56841938 TGTCTAGGTTCTGCTTAAAGGGG + Intergenic
1202624409 Y:56842733-56842755 GGTGTAAGCTCTGCCTAAAGGGG + Intergenic
1202624557 Y:56844026-56844048 TGTCTAAGCTCTGCCTACAGGGG + Intergenic
1202624780 Y:56846144-56846166 TGTCTAGGATCTGCCTAAAGGGG + Intergenic